View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_60 (Length: 276)

Name: NF0095_low_60
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_60
NF0095_low_60
[»] chr7 (1 HSPs)
chr7 (1-224)||(42341796-42342018)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 42342018 - 42341796
Alignment:
1 cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatttaagtataatatgattggttaaaatttcaggaacct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
42342018 cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatt-aagtataatatgattggttaaaatttcaggaacct 42341920  T
101 gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42341919 gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt 42341820  T
201 tcttcctcgtaaaccattcatatc 224  Q
    ||||||||||||||||||||||||    
42341819 tcttcctcgtaaaccattcatatc 42341796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151234 times since January 2019
Visitors: 1526