View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_61 (Length: 270)

Name: NF0095_low_61
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_61
NF0095_low_61
[»] chr4 (1 HSPs)
chr4 (30-257)||(34524333-34524556)
[»] chr5 (1 HSPs)
chr5 (152-230)||(1734611-1734689)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 34524333 - 34524556
Alignment:
30 gatgttagatcccacaagttggatctcaaatgaaccaa-----gttcaagtcaatcaacaaaagcatcgcaattggacaattggtgtaattgttgttcat 124  Q
    ||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||         ||||    
34524333 gatgttagatcccacaagttggatctcaaatgaaccaaaccaagttcaagtcaatcaacaaaagcatcgcaattggacaattggtgt---------tcat 34524423  T
125 cgtttccctaaccatgcacattcctacttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct 224  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
34524424 cgtttccctaaccatgcacattcctacttggttaggagagttttctcttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatct 34524523  T
225 atttcaataccattccaccgttgtagagcctct 257  Q
    ||||||||| |||||||||||||||||||||||    
34524524 atttcaatatcattccaccgttgtagagcctct 34524556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 230
Target Start/End: Original strand, 1734611 - 1734689
Alignment:
152 ttggttaggagacttttcttttacgttaagagcatagtgctctggtgaagagttcttgaactatggtttatctatttca 230  Q
    |||||||||||| |||||| |   |||| ||||||| ||||||| ||| |||||||||||||||||||||||| |||||    
1734611 ttggttaggagagttttctctctggttatgagcataatgctctgttgaggagttcttgaactatggtttatctctttca 1734689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151117 times since January 2019
Visitors: 1526