View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_63 (Length: 265)

Name: NF0095_low_63
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_63
NF0095_low_63
[»] chr8 (3 HSPs)
chr8 (1-194)||(44087905-44088098)
chr8 (1-194)||(44067011-44067204)
chr8 (26-194)||(44092537-44092705)
[»] scaffold0618 (1 HSPs)
scaffold0618 (26-194)||(7206-7374)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 44088098 - 44087905
Alignment:
1 tcatctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
44088098 tcatctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattacc 44087999  T
101 aacagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44087998 aacagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44087905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 44067011 - 44067204
Alignment:
1 tcatctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
44067011 tcatctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattacc 44067110  T
101 aacagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 194  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44067111 aacagaaaatttaactgcatctgaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44067204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 194
Target Start/End: Original strand, 44092537 - 44092705
Alignment:
26 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44092537 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 44092636  T
126 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44092637 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44092705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 194
Target Start/End: Complemental strand, 7374 - 7206
Alignment:
26 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
7374 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 7275  T
126 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7274 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 7206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126461 times since January 2019
Visitors: 1390