View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_64 (Length: 264)

Name: NF0095_low_64
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_64
NF0095_low_64
[»] chr3 (1 HSPs)
chr3 (1-172)||(25644014-25644185)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 25644014 - 25644185
Alignment:
1 taagtatcgatcttaatctaaatgatgaactaatttcatgatattagaataattacaaaactgagatcagatcaagataaagaaaaatggaaacctgaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25644014 taagtatcgatcttaatctaaatgatgaactaatttcatgatattagaataattacaaaactgagatcagatcaagataaagaaaaatggaaacctgaat 25644113  T
101 aagagatagggttccgaataggaacagtgaaaagagaagcaacgacgtcgtttttgccatcggtttgttttg 172  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||    
25644114 aagagatagggttccgaagaggaacagagaaaagagaagcaacgacgtcgtttttgccatcagtttgttttg 25644185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150831 times since January 2019
Visitors: 1523