View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_66 (Length: 264)

Name: NF0095_low_66
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_66
NF0095_low_66
[»] chr8 (3 HSPs)
chr8 (1-193)||(44087905-44088097)
chr8 (1-193)||(44067012-44067204)
chr8 (25-193)||(44092537-44092705)
[»] scaffold0618 (1 HSPs)
scaffold0618 (25-193)||(7206-7374)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 44088097 - 44087905
Alignment:
1 catcacactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattacca 100  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
44088097 catctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattacca 44087998  T
101 acagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44087997 acagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44087905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 44067012 - 44067204
Alignment:
1 catcacactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattacca 100  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
44067012 catctcactttctttgaatgattcaatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattacca 44067111  T
101 acagaaaatttaactgcatcagaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 193  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44067112 acagaaaatttaactgcatctgaaggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44067204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 193
Target Start/End: Original strand, 44092537 - 44092705
Alignment:
25 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
44092537 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 44092636  T
125 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44092637 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 44092705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0618 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold0618
Description:

Target: scaffold0618; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 193
Target Start/End: Complemental strand, 7374 - 7206
Alignment:
25 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaattaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 124  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
7374 aatcaatattcacaaacctgcatcaaacggcacaccactaccagaaatccaagaatcaccagccaaaaaattaccaacagaaaatttaactgcatcagaa 7275  T
125 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7274 ggattagtaataacatgaaaaccaggccatttaactcttccatcagtattagcaccaccaccaacattc 7206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125782 times since January 2019
Visitors: 1390