View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_67 (Length: 262)

Name: NF0095_low_67
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_67
NF0095_low_67
[»] chr3 (1 HSPs)
chr3 (1-238)||(49619321-49619558)


Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 49619321 - 49619558
Alignment:
1 agtgaaaaaagataaaccaatcaaattaaggtaatagaactccaactagatagaatgaggatgtgattgatgctgcagcaatgcttgccgtaatagatct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49619321 agtgaaaaaagataaaccaatcaaattaaggtaatagaactccaactagatagaatgaggatgtgattgatgctgcagcaatgcttgccgtaatagatct 49619420  T
101 tcattactacctactccttcataactagatcaatgaccttacatgggttttcttatactctctttttaaggaaaatcatgtgtgaatttaagatagtagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49619421 tcattactacctactccttcataactagatcaatgaccttacatgggttttcttatactctctttttaaggaaaatcatgtgtgaatttaagatagtagt 49619520  T
201 tcaaattcaaagttgataggatgtacaaactgctgatg 238  Q
    ||||||||||||||||||||||||||||||||||||||    
49619521 tcaaattcaaagttgataggatgtacaaactgctgatg 49619558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150534 times since January 2019
Visitors: 1521