View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_68 (Length: 262)

Name: NF0095_low_68
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_68
NF0095_low_68
[»] chr3 (2 HSPs)
chr3 (1-233)||(49619113-49619345)
chr3 (177-222)||(49614144-49614189)
[»] chr6 (8 HSPs)
chr6 (91-208)||(2930024-2930144)
chr6 (139-210)||(2965243-2965317)
chr6 (95-210)||(2974718-2974830)
chr6 (91-210)||(2952667-2952785)
chr6 (91-173)||(2935353-2935436)
chr6 (140-210)||(2983577-2983650)
chr6 (140-210)||(2996667-2996740)
chr6 (91-210)||(3003010-3003131)
[»] scaffold0024 (1 HSPs)
scaffold0024 (97-184)||(43599-43689)


Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 49619345 - 49619113
Alignment:
1 tttgattggtttatcttttttcacttaccaccatgtaaggtcattgatcccctggttaattattgggggtttcataaatatttcacgcaaaacacctatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
49619345 tttgattggtttatcttttttcacttaccaccatgtaaggtcattgatcccctggttaattattgggggtttcataaatctttcacgcaaaacacctatt 49619246  T
101 tatataatattagaatttcaatctaatacaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataatcatgaac 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49619245 tatataatattagaatttcaatctaatacaacaaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataatcatgaac 49619146  T
201 tcaacaatgattgaacttactactagtacttac 233  Q
    |||||||||||||||||||||||||||||||||    
49619145 tcaacaatgattgaacttactactagtacttac 49619113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 222
Target Start/End: Complemental strand, 49614189 - 49614144
Alignment:
177 ataataatgtcaataatcatgaactcaacaatgattgaacttacta 222  Q
    ||||||||  ||||||| ||||| ||||||||||||||||||||||    
49614189 ataataatcacaataattatgaattcaacaatgattgaacttacta 49614144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 91 - 208
Target Start/End: Complemental strand, 2930144 - 2930024
Alignment:
91 aacacctatttatataatattagaatttcaatctaatacaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataa---tgtc 187  Q
    ||||||||||||||| | |||| |||||  ||||||||||| | |||  ||||||||||||||| ||||||||||||| ||||||||||||||   |  |    
2930144 aacacctatttatatgaaattacaattttgatctaatacaacacacaaaataatgaaaccattgaaacaaacaacgtacattggtgataataagaataac 2930045  T
188 aataatcatgaactcaacaat 208  Q
    |||||| ||||||||||||||    
2930044 aataattatgaactcaacaat 2930024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 210
Target Start/End: Complemental strand, 2965317 - 2965243
Alignment:
139 gataatgaaaccattggaacaaacaacgtaaattggtgataa---taatgtcaataatcatgaactcaacaatga 210  Q
    |||||||||||||||| ||||||||||||| |||||||||||   ||||  ||||||| ||||||||||||||||    
2965317 gataatgaaaccattgaaacaaacaacgtacattggtgataatactaatagcaataattatgaactcaacaatga 2965243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 210
Target Start/End: Complemental strand, 2974830 - 2974718
Alignment:
95 cctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtcaataat 193  Q
    ||||||||||| | |||| |||||||||||||| ||| | || | ||||||||||| |||| ||||||||||||| ||||   |||||||||  ||||||    
2974830 cctatttatatgaaattataatttcaatctaatgcaacacaaaaagataatgaaac-attgaaacaaacaacgtacattg---ataataatgaaaataat 2974735  T
194 catgaactcaacaatga 210  Q
     ||||||||||||||||    
2974734 tatgaactcaacaatga 2974718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 91 - 210
Target Start/End: Complemental strand, 2952785 - 2952667
Alignment:
91 aacacctatttatataatattagaatttcaatctaatacaata--aacatgataatgaaaccattggaacaaacaacgtaaattggtgataataatgtca 188  Q
    |||||| |||||||| | |||| |||||||||||||| ||| |  || |   |||||||||||||| ||||||||||||| |||| | ||||||||   |    
2952785 aacacccatttatatgaaattacaatttcaatctaatgcaacacaaagagattaatgaaaccattgaaacaaacaacgtacattgataataataat---a 2952689  T
189 ataatcatgaactcaacaatga 210  Q
    ||||| ||||||||||||||||    
2952688 ataattatgaactcaacaatga 2952667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 91 - 173
Target Start/End: Complemental strand, 2935436 - 2935353
Alignment:
91 aacacctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaaccattggaacaaacaacgtaaattg 173  Q
    |||||| |||||||| | |||| |||||||||||||| ||| | || | |||||||||||||||| ||||||||||||| ||||    
2935436 aacacccatttatatgaaattacaatttcaatctaatgcaacacaaaaagataatgaaaccattgaaacaaacaacgtacattg 2935353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 2983650 - 2983577
Alignment:
140 ataatgaaaccattggaacaaacaacgtaaattggtgataat---aatgtcaataatcatgaactcaacaatga 210  Q
    ||||||||||||||| ||||||||||||| || |||||||||   |||  ||||||| ||||||||||||||||    
2983650 ataatgaaaccattgaaacaaacaacgtacatgggtgataatgagaataacaataattatgaactcaacaatga 2983577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 2996667 - 2996740
Alignment:
140 ataatgaaaccattggaacaaacaacgtaaattggtgataa---taatgtcaataatcatgaactcaacaatga 210  Q
    ||||||||||||||| |||||||||| || |||||||||||   ||||  ||||||| ||||||||||||||||    
2996667 ataatgaaaccattgaaacaaacaacttacattggtgataatactaatagcaataattatgaactcaacaatga 2996740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 3003010 - 3003131
Alignment:
91 aacacctatttatataatattagaatttcaatctaatacaata-aacatgataatgaaac-cattggaacaaacaacgtaaattggtgataataatgtca 188  Q
    ||||||||||||||| | |||| ||||||||||| || ||| | || | |||||||||||  |||| ||||||| ||||| |||| ||||||||||   |    
3003010 aacacctatttatatgaaattacaatttcaatctgatgcaacacaaaaagataatgaaacatattgaaacaaactacgtacattgatgataataataata 3003109  T
189 ataatcatgaactcaacaatga 210  Q
    ||||| ||||||| ||||||||    
3003110 ataattatgaacttaacaatga 3003131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 97 - 184
Target Start/End: Original strand, 43599 - 43689
Alignment:
97 tatttatataatattagaatttcaatctaat---acaataaacatgataatgaaaccattggaacaaacaacgtaaattggtgataataat 184  Q
    ||||||||| | |||| ||||||||||||||   |||| | |||  ||||||||||||||| ||||||||||||| |||||||||||||||    
43599 tatttatatgaaattacaatttcaatctaattacacaacacacaaaataatgaaaccattgaaacaaacaacgtacattggtgataataat 43689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151245 times since January 2019
Visitors: 1526