View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_70 (Length: 262)

Name: NF0095_low_70
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_70
NF0095_low_70
[»] chr4 (1 HSPs)
chr4 (30-262)||(998921-999153)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 999153 - 998921
Alignment:
30 gaaattgctagacatatctagtatttctggtagatctctatgttattttcttcacaatgtttgattctggttacaagtcacagtatattgaaggtcggaa 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
999153 gaaattgctagacatatctagtatttctggtagatctctatgttattttcttcacaatgtttgattctggttacaagtcacagtatattgaaggtcagaa 999054  T
130 ggagaaatttgtgaggtatttttctttttggatataacatatcaatgtgattggttannnnnnnattcttttcttatctcaactctccggttctcgaggg 229  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
999053 ggagaaatttgtgaggtatttttatttttggatataacatatcaatgtgattggttatttttttattcttttcttatctcaactctccggttctcgaggg 998954  T
230 aaagggactctattaacataagcatctttcaga 262  Q
    |||||||||||||||||||||||||||||||||    
998953 aaagggactctattaacataagcatctttcaga 998921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150544 times since January 2019
Visitors: 1522