View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_71 (Length: 261)

Name: NF0095_low_71
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_71
[»] chr8 (1 HSPs)
chr8 (1-194)||(354574-354767)

Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 354767 - 354574
1 tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg 100  Q
354767 tgttcttcaacaactctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggg 354668  T
101 gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 194  Q
354667 gaaatttattcattttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 354574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151256 times since January 2019
Visitors: 1526