View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_72 (Length: 252)

Name: NF0095_low_72
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_72
NF0095_low_72
[»] chr4 (2 HSPs)
chr4 (28-252)||(3308930-3309161)
chr4 (66-121)||(3227787-3227842)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 28 - 252
Target Start/End: Complemental strand, 3309161 - 3308930
Alignment:
28 cataacaatacttttaagacgcgacagttccagcaccaacagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt------ 121  Q
    |||||||| ||||||||||||||||| |||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||          
3309161 cataacaaaacttttaagacgcgacaattccagaaccaacagctgccaagtcaacaggtgcaattccatgcacattcaaacaaactttcactttcacttt 3309062  T
122 tgactttaagctttgtttaacatcattaacgtgctaatacatatacagaaaatatatcaattaagatgattgttaat-gtcagagataaatgatagatac 220  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
3309061 tgactttaagctttgtttaacatcgttaacgtgctaatacatatatagaaaatatatcaattgagatgattgttaatcgtcagagataaatgatagatac 3308962  T
221 cagatactaaagttgtttaatttgtgatttat 252  Q
    ||||||||||||||||||||| ||||||||||    
3308961 cagatactaaagttgtttaatctgtgatttat 3308930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 66 - 121
Target Start/End: Original strand, 3227787 - 3227842
Alignment:
66 acagttgccaagtcaacagatgcaattccatgcacattcaaacaaactttcacttt 121  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
3227787 acagttgccaagtcaacagatgcaattccatgcacattcaaacgaactttcacttt 3227842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151140 times since January 2019
Visitors: 1526