View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_73 (Length: 252)

Name: NF0095_low_73
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_73
NF0095_low_73
[»] chr2 (4 HSPs)
chr2 (28-249)||(12742341-12742563)
chr2 (40-249)||(10328285-10328493)
chr2 (28-203)||(18354554-18354728)
chr2 (28-249)||(23348227-23348448)
[»] chr7 (1 HSPs)
chr7 (28-203)||(43070629-43070803)
[»] chr5 (3 HSPs)
chr5 (28-203)||(9044504-9044678)
chr5 (28-252)||(30441792-30442017)
chr5 (72-249)||(7472775-7472953)
[»] chr3 (3 HSPs)
chr3 (40-249)||(53972545-53972754)
chr3 (40-249)||(19881369-19881579)
chr3 (213-249)||(37983061-37983097)
[»] scaffold0596 (1 HSPs)
scaffold0596 (40-249)||(1307-1515)
[»] chr8 (1 HSPs)
chr8 (115-203)||(33688074-33688159)
[»] chr1 (1 HSPs)
chr1 (32-124)||(21674755-21674846)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 28 - 249
Target Start/End: Complemental strand, 12742563 - 12742341
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
12742563 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 12742464  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttgnnnnnnnnntacac--atgatttt 225  Q
    ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||         |||||  ||||||||    
12742463 caatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttgaaaaaaaaatacacatatgatttt 12742365  T
226 aaagcatcaatcaatttattaaca 249  Q
    |||| |||||||||||||||||||    
12742364 aaagtatcaatcaatttattaaca 12742341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 40 - 249
Target Start/End: Original strand, 10328285 - 10328493
Alignment:
40 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatattttcaatttataaac 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
10328285 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatattttcaatttataaac 10328384  T
140 acagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttgnnnnnnnnntacacatgattttaaagcatcaatcaa 239  Q
    ||||||| |||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||         ||||||||||||||||| |||||||||    
10328385 acagagcgaagaggaaagcacaatcatt-aaaggtcaacatcaatggacatattggtgtgtttgaaaaaaaaatacacatgattttaaagtatcaatcaa 10328483  T
240 tttattaaca 249  Q
    ||||||||||    
10328484 tttattaaca 10328493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 203
Target Start/End: Original strand, 18354554 - 18354728
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
18354554 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 18354653  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg 203  Q
    ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||    
18354654 caatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttg 18354728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 28 - 249
Target Start/End: Original strand, 23348227 - 23348448
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
23348227 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 23348326  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgttt-gnnnnnnnnntacacatgatttta 226  Q
     |||||||||||||||||| ||| |||||||||||||||| |||||||||||| ||||| |||||||||||||||            |||||||||||||    
23348327 taatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcattaatggacatattggtgtgtttaaaaaaaaaaacacacatgatttta 23348425  T
227 aagcatcaatcaatttattaaca 249  Q
    ||| |||||||||||||||||||    
23348426 aagtatcaatcaatttattaaca 23348448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 203
Target Start/End: Original strand, 43070629 - 43070803
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
43070629 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 43070728  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg 203  Q
    ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||    
43070729 caatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttg 43070803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 9044678 - 9044504
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
9044678 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 9044579  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg 203  Q
    ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||    
9044578 caatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttg 9044504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 28 - 252
Target Start/End: Original strand, 30441792 - 30442017
Alignment:
28 caccagaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatatttt 127  Q
    |||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||    
30441792 caccagaaaagctcccaaaatgacagcagaacccgcacaaaataaaggaattaaacgtaaggaatgttgaataactaaatatacttcgcaatcatatttt 30441891  T
128 caatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttgnnnnnnnnnt--acacatgatttt 225  Q
    ||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||         |  ||| ||||||||    
30441892 caatttataaacacagagcgaagtggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttgaaaaaaaaataaacatatgatttt 30441990  T
226 aaagcatcaatcaatttattaacaaca 252  Q
    |||| ||||||||||||||||||||||    
30441991 aaagtatcaatcaatttattaacaaca 30442017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 72 - 249
Target Start/End: Original strand, 7472775 - 7472953
Alignment:
72 aaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatattttcaatttataaacacagagcaaagaggaaagcacaatcattaaaa 171  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||    
7472775 aaggaattgaacgtaaggaatgttgaataactaaatatacttcgcaatcatattttcaatttataaacacagagcgaagtggaaagcacaatcatt-aaa 7472873  T
172 ggtcagcatcaatgggcatattggtgtgtttgnnnnnnnnntacac--atgattttaaagcatcaatcaatttattaaca 249  Q
    ||||||||||||||| ||||||||||||||||         |||||  |||||||||||| |||||||||||||||||||    
7472874 ggtcagcatcaatggacatattggtgtgtttgaaaaaaaaatacacatatgattttaaagtatcaatcaatttattaaca 7472953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 40 - 249
Target Start/End: Original strand, 53972545 - 53972754
Alignment:
40 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatattttcaatttataaac 139  Q
    |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
53972545 tcccaaaatgacagcagaacccgcgcaagataaatgaattgaacttaaggaatgttgaataactaaatatacttcgcaatcatattttcaatttataaac 53972644  T
140 acagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg-nnnnnnnnntacacatgattttaaagcatcaatca 238  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||          ||||||||||||||||| ||||||||    
53972645 acagagcgaagaggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttgaaaaaaaaaatacacatgattttaaagtatcaatca 53972743  T
239 atttattaaca 249  Q
    |||||||||||    
53972744 atttattaaca 53972754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 40 - 249
Target Start/End: Original strand, 19881369 - 19881579
Alignment:
40 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatattttcaatttataaac 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||    
19881369 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaagaaatgttgaataactaaatatacttcgcaatcatattttcaatttataaac 19881468  T
140 acagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg--nnnnnnnnntacacatgattttaaagcatcaatc 237  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||            |||||||||||||||| |||||||    
19881469 acagagcgaagaggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttgaaaaaaaaaaaaacacatgattttaaagtatcaatc 19881567  T
238 aatttattaaca 249  Q
    ||||||||||||    
19881568 aatttattaaca 19881579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 213 - 249
Target Start/End: Complemental strand, 37983097 - 37983061
Alignment:
213 tacacatgattttaaagcatcaatcaatttattaaca 249  Q
    ||||||||||||||||| |||||||||||||||||||    
37983097 tacacatgattttaaagtatcaatcaatttattaaca 37983061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0596 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0596
Description:

Target: scaffold0596; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 40 - 249
Target Start/End: Complemental strand, 1515 - 1307
Alignment:
40 tcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatattttcaatttataaac 139  Q
    |||||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
1515 tcccaaaatgacagcagaaccatcgcaagataaaggaattgaacttaaggaatgttgaataactaaatatacttcgcaatcatattttcaatttataaac 1416  T
140 acagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttgnnnnnnnnntacacatgattttaaagcatcaatcaa 239  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||         ||||||||||||||||  |||||||||    
1415 acagagcgaagaggaaagcacaatcatt-aaaggtcagcatcaatggacatattggtgtgtttgaaaaaaaaatacacatgattttaaaatatcaatcaa 1317  T
240 tttattaaca 249  Q
    ||||||||||    
1316 tttattaaca 1307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 115 - 203
Target Start/End: Original strand, 33688074 - 33688159
Alignment:
115 gcaatcatattttcaatttataaacacagagcaaagaggaaagcacaatcattaaaaggtcagcatcaatgggcatattggtgtgtttg 203  Q
    |||||||||||||||||||||||||||  | | |||||||||||||||||||| |||||||| ||||||| | ||||||||||||||||    
33688074 gcaatcatattttcaatttataaacac--atcgaagaggaaagcacaatcatt-aaaggtcaacatcaatcgacatattggtgtgtttg 33688159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 32 - 124
Target Start/End: Original strand, 21674755 - 21674846
Alignment:
32 agaaaagctcccaaaatgacagcagaacccgcgcaagataaaggaattgaacgtaaggaatgttgaataactaaatatacttagcaatcatat 124  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| |  ||||| |||||||||||| |||||  |||| ||||| ||||    
21674755 agaaaagctcccaaaatgacagcagaacccgcgccagataaaggaatt-agggtaagaaatgttgaataaataaatcaacttggcaataatat 21674846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151057 times since January 2019
Visitors: 1525