View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_74 (Length: 251)

Name: NF0095_low_74
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_74
NF0095_low_74
[»] chr4 (3 HSPs)
chr4 (1-222)||(47064371-47064592)
chr4 (1-222)||(53301876-53302097)
chr4 (45-98)||(9764872-9764925)
[»] chr2 (3 HSPs)
chr2 (1-222)||(30268550-30268771)
chr2 (8-116)||(31332373-31332481)
chr2 (8-116)||(31339103-31339211)
[»] chr3 (1 HSPs)
chr3 (1-222)||(7404436-7404657)
[»] chr8 (1 HSPs)
chr8 (1-222)||(25640503-25640724)
[»] chr7 (1 HSPs)
chr7 (140-222)||(4683435-4683517)
[»] chr6 (1 HSPs)
chr6 (68-100)||(6761486-6761518)


Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 47064592 - 47064371
Alignment:
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47064592 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 47064493  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47064492 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 47064393  T
201 aatgtgaaaactatgcaaaatc 222  Q
    ||||||||||||||||||||||    
47064392 aatgtgaaaactatgcaaaatc 47064371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 53301876 - 53302097
Alignment:
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53301876 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 53301975  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53301976 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 53302075  T
201 aatgtgaaaactatgcaaaatc 222  Q
    ||||||||||||||||||||||    
53302076 aatgtgaaaactatgcaaaatc 53302097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 98
Target Start/End: Original strand, 9764872 - 9764925
Alignment:
45 tcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacaca 98  Q
    |||||||||| || ||| |||||||||||||||||| | || ||||||||||||    
9764872 tcctatgcaacggaaaggttatacacacataaatcaacaaagcaactaaacaca 9764925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 30268550 - 30268771
Alignment:
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30268550 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 30268649  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30268650 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactagttatcata 30268749  T
201 aatgtgaaaactatgcaaaatc 222  Q
    ||||||||||||||||||||||    
30268750 aatgtgaaaactatgcaaaatc 30268771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 31332481 - 31332373
Alignment:
8 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacataaattgcc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||    
31332481 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacatacattgcc 31332382  T
108 aagtaaact 116  Q
    |||| ||||    
31332381 aagtgaact 31332373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 31339211 - 31339103
Alignment:
8 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacataaattgcc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||    
31339211 gtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacatacattgcc 31339112  T
108 aagtaaact 116  Q
    |||| ||||    
31339111 aagtgaact 31339103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7404657 - 7404436
Alignment:
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
7404657 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacata 7404558  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcat 199  Q
     |||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||| | |||||    
7404557 cattgccaagtaaactaatctgaaaggttagctttcatactgtttgttcaa-tctgaatttctcatgccaaattgcagcattatagaactagataatcat 7404459  T
200 aaatgtgaaaactatgcaaaatc 222  Q
    |||||||||||||||||||||||    
7404458 aaatgtgaaaactatgcaaaatc 7404436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25640503 - 25640724
Alignment:
1 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
25640503 tccttgtgtttttatattgcttcaaacatgaaaagttacatttctcctatgcaatgggaagcttatacacacataaatcagccaaacaactaaacacata 25640602  T
101 aattgccaagtaaactaatctgaaaggttagctttcacactgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcat 199  Q
     |||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| | |||||    
25640603 cattgccaagtaaactaatcttaaaggttagctttcatactgtttgttcaa-tctaaatttctcatgccaaattgcagcgttatagaactagataatcat 25640701  T
200 aaatgtgaaaactatgcaaaatc 222  Q
    |||||||||||||||||||||||    
25640702 aaatgtgaaaactatgcaaaatc 25640724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 4683517 - 4683435
Alignment:
140 ctgtttgttcaattctaaatttctcatgccaaattgcagcattatagaactag-ttatcataaatgtgaaaactatgcaaaatc 222  Q
    ||||||||||||| |||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||    
4683517 ctgtttgttcaat-ctaaatttctcatgccaaattgcagcgttatagaactagataatcataaatgtgaaaactatgcaaaatc 4683435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Original strand, 6761486 - 6761518
Alignment:
68 cacacataaatcatccaaacaactaaacacata 100  Q
    |||||||||||||||||||||||||| ||||||    
6761486 cacacataaatcatccaaacaactaatcacata 6761518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126480 times since January 2019
Visitors: 1390