View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_75 (Length: 250)

Name: NF0095_low_75
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_75
NF0095_low_75
[»] chr2 (3 HSPs)
chr2 (1-204)||(30782259-30782462)
chr2 (1-61)||(30245501-30245561)
chr2 (22-77)||(30061157-30061212)
[»] scaffold1178 (1 HSPs)
scaffold1178 (78-185)||(2225-2332)
[»] chr6 (3 HSPs)
chr6 (78-151)||(14434466-14434539)
chr6 (79-129)||(4479821-4479871)
chr6 (138-179)||(20737891-20737932)
[»] chr8 (4 HSPs)
chr8 (78-129)||(32850563-32850614)
chr8 (79-129)||(37177997-37178047)
chr8 (78-129)||(37173706-37173757)
chr8 (79-129)||(32854858-32854908)
[»] chr3 (1 HSPs)
chr3 (78-129)||(39163943-39163994)
[»] chr1 (1 HSPs)
chr1 (78-169)||(2009522-2009615)


Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 30782462 - 30782259
Alignment:
1 tacaaaataaacattgctttcgcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttcgtgttaaatgataatttgtaatt 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782462 tacaaaataaacattactttcgcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttcgtgttaaatgataatttgtaatt 30782363  T
101 ttccatatttctaggttccttaacgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaatattcctagggttttattagaactt 200  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782362 ttccatattcctaggttccttaatgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaatattcctagggttttattagaactt 30782263  T
201 tcta 204  Q
    ||||    
30782262 tcta 30782259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 30245561 - 30245501
Alignment:
1 tacaaaataaacattgctttcgcaggggtttgaactgaaatcatcatagcaactgcatcag 61  Q
    |||||| |||||||| |||| |||||||||| ||||||| |||||||||||||||||||||    
30245561 tacaaagtaaacattactttagcaggggtttaaactgaagtcatcatagcaactgcatcag 30245501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 30061212 - 30061157
Alignment:
22 gcaggggtttgaactgaaatcatcatagcaactgcatcaggtcgtaattgaggttc 77  Q
    |||||||||| ||| ||| ||||||||||| |||||||||||||||||||||||||    
30061212 gcaggggtttaaaccgaagtcatcatagcagctgcatcaggtcgtaattgaggttc 30061157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1178 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold1178
Description:

Target: scaffold1178; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 78 - 185
Target Start/End: Complemental strand, 2332 - 2225
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtatctgcaagttctagagagggtcatttaata 177  Q
    |||||||||||||||||||||||||||||||| |||||||||||||  |||||| || || ||||||||||| | |||||| |||||  |||||||||||    
2332 gtgttaaatgataatttgtaattttccatattcctaggttccttaatatatctaaaagtctattcatgtatcagtaagttccagagaatgtcatttaata 2233  T
178 ttcctagg 185  Q
    ||||||||    
2232 ttcctagg 2225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 151
Target Start/End: Original strand, 14434466 - 14434539
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtatctg 151  Q
    |||||||||||||||||||||||||||||||| |||||||| |||| |||||||||| ||  | ||||||||||    
14434466 gtgttaaatgataatttgtaattttccatattcctaggttcattaatgtatctagaagtctctccatgtatctg 14434539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 4479871 - 4479821
Alignment:
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||    
4479871 tgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 4479821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 179
Target Start/End: Complemental strand, 20737932 - 20737891
Alignment:
138 cattcatgtatctgcaagttctagagagggtcatttaatatt 179  Q
    ||||||||||||||||||||||||| ||||||||||||||||    
20737932 cattcatgtatctgcaagttctagatagggtcatttaatatt 20737891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 32850614 - 32850563
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||    
32850614 gtgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 32850563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 37178047 - 37177997
Alignment:
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||||||||| ||||||||||||| |||||    
37178047 tgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 37177997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 37173757 - 37173706
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||||||||||| |||||| ||||||||||||| |||||    
37173757 gtgttaaatgataatttgtaatttttcatattcctaggttccttaatgtatc 37173706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 129
Target Start/End: Complemental strand, 32854908 - 32854858
Alignment:
79 tgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    ||||||||||||||||| ||||||||||||| ||||||||||||| |||||    
32854908 tgttaaatgataatttgaaattttccatattcctaggttccttaatgtatc 32854858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 39163994 - 39163943
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatc 129  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||    
39163994 gtgttaaatgataatttgtaattttccatattcctaggttccttaatgtatc 39163943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 169
Target Start/End: Original strand, 2009522 - 2009615
Alignment:
78 gtgttaaatgataatttgtaattttccatatttctaggttccttaacgtatctagaaatccattcatgtat---ctgcaagttctagagagggtc 169  Q
    |||||||||||||||| | |||||| |||||| ||| ||||| ||| |||||||||| | |||||||||||   || ||||||||| ||||||||    
2009522 gtgttaaatgataatt-gaaatttttcatattcctaagttccctaatgtatctagaagttcattcatgtattgactacaagttctaaagagggtc 2009615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126408 times since January 2019
Visitors: 1390