View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_76 (Length: 236)

Name: NF0095_low_76
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_76
[»] chr4 (1 HSPs)
chr4 (30-236)||(998519-998725)

Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 30 - 236
Target Start/End: Complemental strand, 998725 - 998519
30 ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaaggatttgatcctcaagataagaatcttattt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||    
998725 ggaagatcactcaaaagtggagtcacttggggagtttttccagaagatcttaaagtgtcacagaaaaaagtatttgatcctcaagataagaatcttcttt 998626  T
130 attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttcnnnnnnnctcttccttatttcaaccacaaatcatattgtttagc 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
998625 attggaacaagtttttcgagattctatgcatcctttctgtagcttgtgatcctttctttttttatcttccttatttcaaccacaaatcatattgtttagc 998526  T
230 catagat 236  Q
998525 catagat 998519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 126326 times since January 2019
Visitors: 1390