View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_77 (Length: 229)

Name: NF0095_low_77
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_77
NF0095_low_77
[»] chr2 (4 HSPs)
chr2 (1-132)||(10328422-10328553)
chr2 (1-96)||(23348413-23348508)
chr2 (1-92)||(12742281-12742372)
chr2 (1-92)||(18354744-18354835)
[»] scaffold0596 (1 HSPs)
scaffold0596 (1-132)||(1247-1378)
[»] chr3 (3 HSPs)
chr3 (1-97)||(37983001-37983097)
chr3 (1-97)||(53972718-53972814)
chr3 (1-96)||(19881544-19881639)
[»] chr5 (3 HSPs)
chr5 (1-92)||(30441983-30442074)
chr5 (1-92)||(7472922-7473013)
chr5 (1-92)||(9044395-9044486)
[»] chr7 (1 HSPs)
chr7 (1-92)||(43070819-43070910)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 10328553 - 10328422
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgtannn 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||       
10328553 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgtattt 10328454  T
101 nnnnnncaaacacaccaatatgcccattgatg 132  Q
          |||||||||||||||| |||||||||    
10328453 ttttttcaaacacaccaatatgtccattgatg 10328422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23348508 - 23348413
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgt 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||    
23348508 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 23348413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 12742281 - 12742372
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
12742281 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 12742372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 18354835 - 18354744
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||    
18354835 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcat 18354744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0596 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: scaffold0596
Description:

Target: scaffold0596; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 1247 - 1378
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgtannn 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||  ||||||||||||||||       
1247 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatattttaaaatcatgtgtattt 1346  T
101 nnnnnncaaacacaccaatatgcccattgatg 132  Q
          |||||||||||||||| |||||||||    
1347 ttttttcaaacacaccaatatgtccattgatg 1378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 37983001 - 37983097
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgta 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||    
37983001 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgta 37983097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 53972814 - 53972718
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgta 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||    
53972814 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgta 53972718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 19881639 - 19881544
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcatgtgt 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||    
19881639 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcatgtgt 19881544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 30442074 - 30441983
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
30442074 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatactttaaaatcat 30441983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 7473013 - 7472922
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
7473013 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 7472922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 9044395 - 9044486
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||    
9044395 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctgttaataaattgattgatactttaaaatcat 9044486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 43070910 - 43070819
Alignment:
1 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgttgttaataaattgattgatgctttaaaatcat 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||    
43070910 ttggtttgtttgtaagtgaattgatgatatttaaatagattttaccatcatgtattatgctcttaataaattgattgatactttaaaatcat 43070819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149037 times since January 2019
Visitors: 1515