View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_79 (Length: 227)

Name: NF0095_low_79
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_79
NF0095_low_79
[»] chr2 (5 HSPs)
chr2 (7-227)||(30782518-30782738)
chr2 (7-159)||(30245591-30245741)
chr2 (8-77)||(30005306-30005377)
chr2 (8-53)||(30062036-30062081)
chr2 (100-137)||(30782512-30782549)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 30782738 - 30782518
Alignment:
7 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782738 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 30782639  T
107 ggacataactcgctaatagagagcatcaaaaccattattgcaataaataacaagacacgttttgttgcaggtataaggactctctaccacaaatctggac 206  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30782638 ggacataactcgctaatagagagcataaaaaccattattgcaataaataacaagacacgttttgttgcaggtataaggactctctaccacaaatctggac 30782539  T
207 ataactcgctagtagagagca 227  Q
    |||||||||||||||||||||    
30782538 ataactcgctagtagagagca 30782518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 7 - 159
Target Start/End: Complemental strand, 30245741 - 30245591
Alignment:
7 aattcctcttttacaagacacgtgactttaacaacattatttatagtgtcaaggtctttataagttttatcgaaattaaggtctttatagtgtcaaatct 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||  ||||||||||||||||||||    
30245741 aattcctcttttacaagaaacgtgactttaacaacattatttatagtgtcaaggtgtttataggttttatcaaaattatagtctttatagtgtcaaatct 30245642  T
107 ggacataactcgctaatagagagcatcaaaaccattattgcaataaataacaa 159  Q
    |||||||||||||||||||||||||||||||||||  |||||||||| |||||    
30245641 ggacataactcgctaatagagagcatcaaaaccat--ttgcaataaacaacaa 30245591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 30005377 - 30005306
Alignment:
8 attcctcttttacaagacacgtgactttaacaacattatttat--agtgtcaaggtctttataagttttatc 77  Q
    |||| ||||||  ||||||||||||||||||||||| ||||||  |||||||||||||||||| ||||||||    
30005377 attcatcttttctaagacacgtgactttaacaacatcatttatagagtgtcaaggtctttatatgttttatc 30005306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 30062081 - 30062036
Alignment:
8 attcctcttttacaagacacgtgactttaacaacattatttatagt 53  Q
    |||| ||||||  ||||||||||||||||||||||| |||||||||    
30062081 attcatcttttgtaagacacgtgactttaacaacatcatttatagt 30062036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 30782549 - 30782512
Alignment:
100 caaatctggacataactcgctaatagagagcatcaaaa 137  Q
    |||||||||||||||||||||| |||||||||| ||||    
30782549 caaatctggacataactcgctagtagagagcataaaaa 30782512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151268 times since January 2019
Visitors: 1526