View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_80 (Length: 207)

Name: NF0095_low_80
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095_low_80
NF0095_low_80
[»] chr4 (1 HSPs)
chr4 (84-207)||(50742518-50742641)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 84 - 207
Target Start/End: Original strand, 50742518 - 50742641
Alignment:
84 catcatcaagcctgtcttcaacatgtgccggtgctgtcgctagaccaaagaaaaacccattttcttcttctgcaaaagtaaataaataagccatgtttat 183  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50742518 catcatcaagcctgtcttcaacatgcgccggtgctgtcgctagaccaaagaaaaacccattttcttcttctgcaaaagtaaataaataagccatgtttat 50742617  T
184 attggctcatttgaacttacatac 207  Q
    ||||||||||||||||||||||||    
50742618 attggctcatttgaacttacatac 50742641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 150673 times since January 2019
Visitors: 1522