View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095_low_9 (Length: 506)

Name: NF0095_low_9
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0095_low_9
[»] chr2 (2 HSPs)
chr2 (30-294)||(42954495-42954760)
chr2 (395-497)||(42954290-42954392)

Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 30 - 294
Target Start/End: Complemental strand, 42954760 - 42954495
30 gatttggtacgataaattatcattttatctgtgaacatgaaatgcaacaaagttctaaatgatttggtac-aataaaatagttagtataattgaatcttt 128  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
42954760 gatttggtacgataaactatcattttatctgtgaacatgaaatgcaacaaagttctaaatgatttggtaccaataaaatagttagtataattgaatcttt 42954661  T
129 acatactaaaccgaacaataatcatatcacattgacttgatcttagtctttaattaatctgtgaataatgagattgagaaattaagtgtgaggagcatta 228  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42954660 acctactaaaccgaacaataatcatatcacattgacttgatcttagtctttaattaatctgtgaataatgagattgagaaattaagtgtgaggagcatta 42954561  T
229 tgtacgcgcttaacatgagagtaaagtgctggatacagctaaaaactagtagttagaatgttgcaa 294  Q
42954560 tgtacgcgcttaacatgagagtaaagtgctggatacagctaaaaactagtagttagaatgttgcaa 42954495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 395 - 497
Target Start/End: Complemental strand, 42954392 - 42954290
395 ttggtgattaattcctttcatatattctactaccactggtactttcttcttaatccaccttttagttaacctcaaaaccagaaacacactccctctattt 494  Q
    ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
42954392 ttggtgattaattcctttcctatattctactaccactagtactttcttcttaatccaccttttagttaacctcaaaaccaaaaacacactccctctattt 42954293  T
495 cat 497  Q
42954292 cat 42954290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151276 times since January 2019
Visitors: 1526