View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-1 (Length: 855)

Name: NF0110-INSERTION-1
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0110-INSERTION-1
NF0110-INSERTION-1
[»] chr3 (8 HSPs)
chr3 (122-508)||(8378712-8379095)
chr3 (653-855)||(8375263-8375466)
chr3 (512-625)||(8375493-8375606)
chr3 (269-441)||(8367648-8367823)
chr3 (8-70)||(8379148-8379214)
chr3 (307-410)||(8358424-8358520)
chr3 (263-410)||(8420918-8421059)
chr3 (307-430)||(8235650-8235772)
[»] chr5 (4 HSPs)
chr5 (8-70)||(5033566-5033628)
chr5 (8-70)||(16019843-16019905)
chr5 (156-227)||(5034776-5034845)
chr5 (176-209)||(16020230-16020263)
[»] chr1 (1 HSPs)
chr1 (8-69)||(46468839-46468900)
[»] chr4 (2 HSPs)
chr4 (156-227)||(20851003-20851077)
chr4 (8-65)||(30252122-30252179)


Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 122 - 508
Target Start/End: Complemental strand, 8379095 - 8378712
Alignment:
122 cttaaacaactacaaaaagagttttactaatggaaaaaattatcaagacaccagtcaatatatattttatctcatttctttatatttgagaccctcgtat 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
8379095 cttaaacaactacaaaaagagttttactaatggaaaaaattatcaagacaccagtcaatatatattttatcttatttctttatatttgagaccctcgtat 8378996  T
222 aaagatcgcggctgactttatgaatttatgcattttatccctttgttttcaaatgatggtaaacaattatttattgtttatactattttagtatagttat 321  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
8378995 aaagatcgcggctgactttatgaatttatgcattttatcactttgttttcaaatgatggtaaacaattatttattgtttatactgttttagtatagttat 8378896  T
322 ttgaaataaaatctttagtaaattacaacatgcttccttaagagatttatatagtacactctcctcccctcttgttttgaaacacacaaccctcacttaa 421  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||| ||    
8378895 ttgaaataaaatctttagtaaattacaacatgcttccttaagagatttatatagtacactctcctcc---cttgttttgaaacacacaaccctcactcaa 8378799  T
422 aaaatgaatgactaatttgagattggaaattaggagaaagaatcaaagactaaaaattctcgattaattttattatataatgtgaaa 508  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||    
8378798 aaaatgaatgactaatttgagattggaaattaggagaaagaatcaaagactaaaaattctcgattaattttactttataatgtgaaa 8378712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 172; E-Value: 6e-92
Query Start/End: Original strand, 653 - 855
Target Start/End: Complemental strand, 8375466 - 8375263
Alignment:
653 ttagatttgaaactgaatcaatgtattaat-ggtgtgatttcgacagcagggtaaggtcttttttaaagatctacaagagaaacactcgcaaacgtcttt 751  Q
    ||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
8375466 ttagatttgaaactgaatcaaagtattaatcggtgtgatttcgacagcagggtaaagtcttttttaaagatctacaggagaaacactcgcaaacgtcttt 8375367  T
752 aaagccacttgataaagaataataattaacattcattatcttgttattgatatactactcctggtagtcatgttgtgaatgtcaattttgcctgtactag 851  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
8375366 aaagccacttgataaagaataataattaagattcattatcttgttattgatatactactcctggtagtcatgttgtgaatgtcaattttgtatgtactag 8375267  T
852 ttag 855  Q
    ||||    
8375266 ttag 8375263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 512 - 625
Target Start/End: Complemental strand, 8375606 - 8375493
Alignment:
512 caagtgaaatgactctaaatttacgatgataacatgaacaatgcaatgtagaatttatcatagtatcaagtgcacgggaagagttgttactttgtatttg 611  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
8375606 caagtgaaatgactctaaatttatgatgataacatgaacaatgcaatgtagaatttatcatagtatcaagtgcacgggaagagttattactttgtatttg 8375507  T
612 ttacaacattgata 625  Q
    ||||||||||||||    
8375506 ttacaacattgata 8375493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 269 - 441
Target Start/End: Complemental strand, 8367823 - 8367648
Alignment:
269 ttcaaatgatggtaaaca--attatttattgtttatactatttt-agtatagttatttgaaataaaatctttagtaaattacaacatgcttccttaagag 365  Q
    |||||||| |||||||||  | ||||||||||||||| | |||| ||||||||||||||||||||||| |  |||||||| |||||||||| ||||| ||    
8367823 ttcaaatgttggtaaacataaatatttattgtttatattgtttttagtatagttatttgaaataaaatttagagtaaattgcaacatgcttacttaaaag 8367724  T
366 atttatatagtacactctcctcccctcttgttttgaaacacacaaccctcacttaaaaaatgaatgactaatttga 441  Q
    ||   ||||| |||||||||||||||||||||||||||||| | |  ||  || |||| |||||||||||||||||    
8367723 atccttatagaacactctcctcccctcttgttttgaaacacgccattcttcctcaaaagatgaatgactaatttga 8367648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 8379214 - 8379148
Alignment:
8 atatttaactacca----caaatgattttatttgttgaaatttagtataaataaaaatgttagtaag 70  Q
    ||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||    
8379214 atatttaactaccacaaacaaatgattttatttgttgaaatttagtataaataaaaatgttagtaag 8379148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 307 - 410
Target Start/End: Complemental strand, 8358520 - 8358424
Alignment:
307 ttttagtatagttatttgaaataaaatctttagtaaattacaacatgcttccttaagagatttatatagtacactctcctcccctcttgttttgaaacac 406  Q
    ||||||||||||||||||||||||||  |  ||||||||||| |||||||       ||||   |||||||| |||||||||||||||||||||||||||    
8358520 ttttagtatagttatttgaaataaaaattagagtaaattacagcatgctt-------agatccttatagtacgctctcctcccctcttgttttgaaacac 8358428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 263 - 410
Target Start/End: Original strand, 8420918 - 8421059
Alignment:
263 tttgttttcaaatgatggtaaacaattatttattgtttatactatttt-agtatagttatttgaaataaaatctttagtaaattacaacatgcttcctta 361  Q
    ||||||||||||||||||||||||     | ||| |||||| |||||| || |||||||||||||||||||| || ||||||||||||||| |||  | |    
8420918 tttgttttcaaatgatggtaaaca-----taattatttatattatttttaggatagttatttgaaataaaattttgagtaaattacaacatcctttttca 8421012  T
362 agagatttatatagtacactctcctcccctcttgttttgaaacacacaa 410  Q
    ||||||   | | ||||| ||||||   |||||||||||||||||||||    
8421013 agagatccttgtggtacattctcct--tctcttgttttgaaacacacaa 8421059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 307 - 430
Target Start/End: Complemental strand, 8235772 - 8235650
Alignment:
307 ttttagtatagttatttgaaataaaatctttagtaaattacaacatgcttcctt---aagagatttatatagtacactctcctcccctcttgttttgaaa 403  Q
    |||| ||||||||||||||||||||||    ||| ||||||||||  |||||||   |||| || | |||||||||||||||    ||||| ||||||||    
8235772 tttttgtatagttatttgaaataaaattaagagtgaattacaacactcttcctttttaagatatctttatagtacactctcc----ctcttcttttgaaa 8235677  T
404 cacacaaccctcacttaaaaaatgaat 430  Q
    ||||||| |||| || |||| ||||||    
8235676 cacacaatcctccctcaaaagatgaat 8235650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.000000000001; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 5033566 - 5033628
Alignment:
8 atatttaactaccacaaatgattttatttgttgaaatttagtataaataaaaatgttagtaag 70  Q
    |||||||| |||||||||||| ||||||||| ||||||||||||| || ||||||||| ||||    
5033566 atatttaaataccacaaatgagtttatttgtcgaaatttagtatatattaaaatgttaataag 5033628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 16019843 - 16019905
Alignment:
8 atatttaactaccacaaatgattttatttgttgaaatttagtataaataaaaatgttagtaag 70  Q
    ||||||| ||| ||||||| | |||||||||  ||||||||||||||||||||||||| ||||    
16019843 atatttagctaacacaaataaatttatttgtcaaaatttagtataaataaaaatgttattaag 16019905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 227
Target Start/End: Original strand, 5034776 - 5034845
Alignment:
156 aaaaattatcaagacaccagtcaatatatattttatctcatttctttatatttgagaccctcgtataaagat 227  Q
    |||||||||||||||  |||||  ||||||||||| || ||||||||||||||| | | |||||||||||||    
5034776 aaaaattatcaagactacagtc--tatatattttaccttatttctttatatttgggcctctcgtataaagat 5034845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 209
Target Start/End: Original strand, 16020230 - 16020263
Alignment:
176 tcaatatatattttatctcatttctttatatttg 209  Q
    |||||||||||||||||| |||||||||||||||    
16020230 tcaatatatattttatcttatttctttatatttg 16020263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 46468839 - 46468900
Alignment:
8 atatttaactaccacaaatgattttatttgttgaaatttagtataaataaaaatgttagtaa 69  Q
    ||||||||||| || |||||| ||||||||| ||||||||| |||||||||||||| |||||    
46468839 atatttaactatcataaatgagtttatttgtcgaaatttagaataaataaaaatgtcagtaa 46468900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000008; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 227
Target Start/End: Original strand, 20851003 - 20851077
Alignment:
156 aaaaattatcaagacaccagtcaatatatatttt----atctcatttctttatatttgagaccctcgtataaagat 227  Q
    |||||||||||||| | || ||||||||||||||    |||| ||||||||||||||||  |||||||||||||||    
20851003 aaaaattatcaagataacactcaatatatattttttaaatcttatttctttatatttga-cccctcgtataaagat 20851077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 30252122 - 30252179
Alignment:
8 atatttaactaccacaaatgattttatttgttgaaatttagtataaataaaaatgtta 65  Q
    |||||||  ||| |||||||| ||||||||||||||  ||||| ||||||||||||||    
30252122 atatttagttactacaaatgagtttatttgttgaaaactagtagaaataaaaatgtta 30252179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137425 times since January 2019
Visitors: 1447