View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-2 (Length: 848)

Name: NF0110-INSERTION-2
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0110-INSERTION-2
NF0110-INSERTION-2
[»] chr3 (2 HSPs)
chr3 (241-838)||(49997970-49998566)
chr3 (8-249)||(49997413-49997654)
[»] chr8 (1 HSPs)
chr8 (8-267)||(24803154-24803411)
[»] chr4 (1 HSPs)
chr4 (8-267)||(52658359-52658615)
[»] chr5 (1 HSPs)
chr5 (54-108)||(25518166-25518220)
[»] chr1 (1 HSPs)
chr1 (54-108)||(19720281-19720335)


Alignment Details
Target: chr3 (Bit Score: 554; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 554; E-Value: 0
Query Start/End: Original strand, 241 - 838
Target Start/End: Original strand, 49997970 - 49998566
Alignment:
241 taatatattccgtgatgattgaattaatagcttcacaatgacacgtagtttatatacaaccaaaaaacttatcacggaggtatgcattggcccacaatga 340  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49997970 taatatattccgtgatgattgaattaatagcttcacaatgacacgtagtttatatacaaccaaaaaacttatcacggaggtatgcattggcccacaatga 49998069  T
341 cctattctcataggttctagaaacccattcattccccgcaatttcgtgctgcacaaccatctttatccaaaaatcttcaaattctttcgagctgaaattt 440  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
49998070 cctattctcataggttctagaaacccattcattccccgcaatttcgtgctgcacaaccatctttatccaaaaatcttcaaattctttcgggctgaaattt 49998169  T
441 gagtaagttgcctttttaaaatcctccaaaaatgaagaactctcaacatttttacatgcattcttgtgcaagttccaaacacatagttgatgacatgaat 540  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49998170 gagtaagttgcctttttgaaatcctccaaaaatgaagaactctcgacatttttacatgcattcttgtgcaagttccaaacacatagttgatgacatgaat 49998269  T
541 ccggaaaaacatgttttatagcctccatcatgacctcatccccatttgtcacaacaacttcgggatgtttatttcgcattgcttctgaaaaagattttaa 640  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
49998270 ccggaaaaacatgttttatagcctccatcatgacctcatccccatttgtcacaacaactttgggatgtttatttcgcattgcttctgaaaaagattttaa 49998369  T
641 gacccacttatagttctcaattgtttcatccgacatcaaagcacagccaaatataattggttgagaatgatgattgcacccggataaaattaccaatgga 740  Q
    ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
49998370 gacccacttataggtctcaattgtttcatccgacatcaaagcacaaccaaatataattggttgagaatgatgattgcacccggagaaaattaccaatgga 49998469  T
741 caattgtatttgttcttctcgtgcgtcgtgtcaagtacaagaacatcgttgaaacatagataatcagatatgctacatccatctgcccaacaaagttg 838  Q
    |||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
49998470 caattgtatttgttcttctcgtgcgtggtgt-aagtacaagaacatcgttgaaacatagataatcagatatgctacatccatctgcccaaaaaagttg 49998566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 49997413 - 49997654
Alignment:
8 taccattcgcttaataacatttaatgcaccagccaatgcaatctgctctttaacttccttaaaaatctctgttgtgtaaatttttgcagcatcattctca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
49997413 taccattcgcttaataacatttaatgcaccagccaatgcaatctgctctttaacttccttaaaaatctctgttgtgtaaatttttgcagaatcattctca 49997512  T
108 aactcttgaagagacgtggtcaacacaggttctgaatataaagacttgttatcagccatcagctcattgtttctatattttctcaaagtctgctcaaaac 207  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49997513 aactcttgaagagacttggtcaacacaggttctgaatataaagacttgttatcagccatcagctcattgtttctatattttctcaaagtctgctcaaaac 49997612  T
208 taagcataaattcaaaaacgttgtttttcttcataatatatt 249  Q
    |||||||||||||||||||| || ||||||||||||||||||    
49997613 taagcataaattcaaaaacgctgattttcttcataatatatt 49997654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 195; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-105
Query Start/End: Original strand, 8 - 267
Target Start/End: Complemental strand, 24803411 - 24803154
Alignment:
8 taccattcgcttaataacatttaatgcaccagccaatgcaatctgctctttaacttccttaaaaatctctgttgtgtaaatttttgcagcatcattctca 107  Q
    ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
24803411 taccattcgcttaataacatttaatgcaccaaccaatacaatctgctctttaactt---taaaaatctctgttgtgtaaatttttgcagcatcattctca 24803315  T
108 aactcttgaagagacgtggtcaacacaggttctgaatataaagacttgttatcagccatcagctcattgtttctatattttctcaaagtc-tgctcaaaa 206  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||    
24803314 aactcttgaagagacgtggtcaacacaggttttgaatacaaagacttgttgtgagccatcagctcattgtttctatattttctcaaagtcttgctcaaaa 24803215  T
207 ctaagcataaattcaaaaacgttgtttttcttcataatatattccgtgatgattgaattaa 267  Q
    |||||||||||||| ||||| ||| |||||||||||||||| || ||||||||||||||||    
24803214 ctaagcataaattccaaaacattgattttcttcataatatactcggtgatgattgaattaa 24803154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 175; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 9e-94
Query Start/End: Original strand, 8 - 267
Target Start/End: Original strand, 52658359 - 52658615
Alignment:
8 taccattcgcttaataacatttaatgcaccagccaatgcaatctgctctttaacttccttaaaaatctctgttgtgtaaatttttgcagcatcattctca 107  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||    
52658359 taccattcgcttaataacgtttaatgcaccagccaatacaatctgctctttaactt---taaaaatctctgttgtgtaaatttttgcagcatcattctca 52658455  T
108 aactcttgaagagacgtggtcaacacaggttctgaatataaagacttgttatcagccatcagctcattgtttctatattttctcaaagtct-gctcaaaa 206  Q
    |||||||||||||| | ||||||||||| || | |||| ||||||||||||| |||||||| ||||||||||||||||||||||||||| | ||||||||    
52658456 aactcttgaagagatg-ggtcaacacagattttaaatacaaagacttgttatgagccatcaactcattgtttctatattttctcaaagtttggctcaaaa 52658554  T
207 ctaagcataaattcaaaaacgttgtttttcttcataatatattccgtgatgattgaattaa 267  Q
    |||||||||||||| ||||| ||| ||||||||||||||||||| ||||||||||||||||    
52658555 ctaagcataaattccaaaacattgattttcttcataatatattcggtgatgattgaattaa 52658615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 54 - 108
Target Start/End: Original strand, 25518166 - 25518220
Alignment:
54 tctttaacttccttaaaaatctctgttgtgtaaatttttgcagcatcattctcaa 108  Q
    ||||||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||    
25518166 tctttaacttctttaaagatctctgctgtgtaaattttggcagcatcaatctcaa 25518220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 108
Target Start/End: Complemental strand, 19720335 - 19720281
Alignment:
54 tctttaacttccttaaaaatctctgttgtgtaaatttttgcagcatcattctcaa 108  Q
    ||||||||||| ||||| ||||||| |||||||||| | ||||||||| ||||||    
19720335 tctttaacttctttaaagatctctgctgtgtaaattctggcagcatcaatctcaa 19720281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136918 times since January 2019
Visitors: 1443