View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-5 (Length: 548)

Name: NF0110-INSERTION-5
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0110-INSERTION-5
NF0110-INSERTION-5
[»] chr3 (21 HSPs)
chr3 (306-537)||(43921859-43922089)
chr3 (306-524)||(11410699-11410917)
chr3 (307-546)||(21408758-21409005)
chr3 (310-535)||(10516084-10516308)
chr3 (310-546)||(10657344-10657580)
chr3 (398-546)||(26565408-26565556)
chr3 (403-515)||(14218512-14218624)
chr3 (306-482)||(27063756-27063932)
chr3 (421-507)||(49861100-49861186)
chr3 (409-514)||(27109671-27109776)
chr3 (307-388)||(2227285-2227366)
chr3 (421-507)||(27109280-27109366)
chr3 (155-241)||(43922153-43922239)
chr3 (318-536)||(17715758-17715979)
chr3 (318-536)||(19016987-19017208)
chr3 (342-388)||(27109378-27109424)
chr3 (342-388)||(27109776-27109822)
chr3 (335-388)||(49860462-49860515)
chr3 (195-247)||(11410589-11410641)
chr3 (109-145)||(10540871-10540907)
chr3 (159-247)||(14218323-14218411)
[»] chr4 (11 HSPs)
chr4 (306-546)||(17732789-17733032)
chr4 (323-523)||(31734528-31734725)
chr4 (310-537)||(40289069-40289294)
chr4 (306-542)||(45612347-45612581)
chr4 (310-386)||(54305676-54305752)
chr4 (409-482)||(3419971-3420043)
chr4 (438-507)||(658424-658493)
chr4 (314-388)||(2641164-2641238)
chr4 (306-375)||(55680753-55680822)
chr4 (306-385)||(44507704-44507782)
chr4 (155-247)||(54305522-54305614)
[»] chr6 (15 HSPs)
chr6 (310-533)||(1255581-1255804)
chr6 (306-507)||(12843919-12844119)
chr6 (306-548)||(17540033-17540275)
chr6 (306-546)||(14494345-14494585)
chr6 (403-546)||(57109-57253)
chr6 (306-525)||(19542154-19542373)
chr6 (306-388)||(34708944-34709026)
chr6 (306-388)||(19294401-19294480)
chr6 (403-507)||(34709065-34709168)
chr6 (306-378)||(34011225-34011297)
chr6 (306-378)||(34013553-34013625)
chr6 (306-356)||(57024-57074)
chr6 (306-388)||(33234919-33234999)
chr6 (438-499)||(34011158-34011219)
chr6 (438-499)||(34013631-34013692)
[»] chr7 (15 HSPs)
chr7 (306-542)||(37338675-37338909)
chr7 (306-533)||(46532870-46533097)
chr7 (306-545)||(27616341-27616569)
chr7 (434-535)||(10678436-10678536)
chr7 (309-388)||(45216027-45216106)
chr7 (310-388)||(22290882-22290960)
chr7 (487-537)||(44572431-44572481)
chr7 (436-527)||(44182375-44182466)
chr7 (307-384)||(32716581-32716658)
chr7 (155-224)||(37338989-37339058)
chr7 (308-388)||(11810979-11811058)
chr7 (310-355)||(27993922-27993967)
chr7 (342-378)||(10678399-10678435)
chr7 (195-247)||(11812705-11812757)
chr7 (487-546)||(45215927-45215989)
[»] chr8 (17 HSPs)
chr8 (306-537)||(18602985-18603203)
chr8 (307-537)||(15850382-15850601)
chr8 (310-529)||(28421061-28421281)
chr8 (306-548)||(15131870-15132113)
chr8 (310-469)||(44502311-44502469)
chr8 (317-534)||(1226083-1226300)
chr8 (306-388)||(27401839-27401921)
chr8 (306-388)||(37855176-37855258)
chr8 (307-388)||(2889798-2889879)
chr8 (307-388)||(3145256-3145337)
chr8 (307-386)||(3159848-3159927)
chr8 (310-388)||(18393615-18393693)
chr8 (155-237)||(18603271-18603353)
chr8 (307-388)||(2875443-2875524)
chr8 (158-241)||(15850666-15850749)
chr8 (207-247)||(3159758-3159798)
chr8 (155-243)||(44502157-44502245)
[»] chr2 (17 HSPs)
chr2 (306-546)||(26576077-26576319)
chr2 (306-534)||(34409500-34409727)
chr2 (306-507)||(9929647-9929865)
chr2 (306-507)||(27004051-27004254)
chr2 (314-537)||(44649883-44650106)
chr2 (308-537)||(4747996-4748224)
chr2 (306-388)||(32200887-32200969)
chr2 (306-388)||(13037324-13037406)
chr2 (437-535)||(13039025-13039124)
chr2 (438-546)||(32200747-32200857)
chr2 (306-388)||(17651275-17651357)
chr2 (307-376)||(16661253-16661322)
chr2 (155-247)||(9929497-9929589)
chr2 (421-504)||(15990017-15990100)
chr2 (198-246)||(4748264-4748312)
chr2 (318-388)||(38783674-38783744)
chr2 (198-246)||(41848928-41848976)
[»] chr5 (6 HSPs)
chr5 (314-534)||(32676552-32676773)
chr5 (359-542)||(40837972-40838153)
chr5 (306-468)||(38989237-38989396)
chr5 (306-373)||(40837822-40837889)
chr5 (198-247)||(32676838-32676887)
chr5 (306-385)||(41815678-41815757)
[»] chr1 (14 HSPs)
chr1 (306-534)||(32740866-32741091)
chr1 (306-546)||(23431883-23432126)
chr1 (310-535)||(48632501-48632725)
chr1 (306-388)||(18476522-18476605)
chr1 (307-545)||(9148908-9149143)
chr1 (419-546)||(18488337-18488465)
chr1 (362-473)||(126324-126435)
chr1 (306-482)||(7021539-7021718)
chr1 (306-388)||(3954966-3955048)
chr1 (310-387)||(3387675-3387752)
chr1 (307-369)||(125194-125256)
chr1 (201-247)||(10171653-10171699)
chr1 (306-388)||(50127225-50127306)
chr1 (306-356)||(19415663-19415713)
[»] scaffold0019 (1 HSPs)
scaffold0019 (310-548)||(69976-70215)
[»] scaffold0325 (1 HSPs)
scaffold0325 (310-463)||(12898-13051)
[»] scaffold1723 (1 HSPs)
scaffold1723 (306-385)||(404-483)
[»] scaffold0012 (1 HSPs)
scaffold0012 (317-387)||(209216-209286)
[»] scaffold0891 (1 HSPs)
scaffold0891 (306-375)||(2363-2431)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 3e-77; HSPs: 21)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 306 - 537
Target Start/End: Complemental strand, 43922089 - 43921859
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||| | |       |||| |||    
43922089 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagacatcgtagtatttgatctttatttattcatctaatatcaaaaaagctaaaaa 43921990  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    |||||||||||||||||||||| |||| ||| | |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
43921989 tgttataatcaattgtaatgtcaattaaccc-tgattgatcaacatttctcaaaacatatgtaactcttgtatctactgtatgtggaagcaagagagaaa 43921891  T
506 aagatgtttttgatatttgtctgagttgtccg 537  Q
    || ||| ||| |||||||||||||||||||||    
43921890 aaaatgctttagatatttgtctgagttgtccg 43921859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 306 - 524
Target Start/End: Original strand, 11410699 - 11410917
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||| |       |||| ||     
11410699 catctaacttgagcaagttatttcattagaaaaagttctaaaagaagatatcgtagtatttaacctttatttattcatctactatcaaaaaggctaaaac 11410798  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    ||||||||||||   |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||    
11410799 tgttataatcaacaataatatctattaccccctaattgatcaacatttctcaaaacatatgtaactcttgtatctacggtatgtggaagtaagagagaaa 11410898  T
506 aagatgtttttgatatttg 524  Q
    || ||||||| ||||||||    
11410899 aaaatgttttcgatatttg 11410917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 307 - 546
Target Start/End: Complemental strand, 21409005 - 21408758
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaat 406  Q
    |||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||| |       | || ||||    
21409005 atctaatttgagcaagttatttcattagaaaaaattctaaaataagatatcgtagtatttgacctttatttattcatctactataaaaaaggttaaaaat 21408906  T
407 gttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaa--------acatatgtaactcttgtatctacagtatgtggaagcaag 498  Q
    |||||||||||||||||||| | |||||||||||||||||||||||| |||||        ||||||||||||||||||||||   ||||||||||||||    
21408905 gttataatcaattgtaatgtttgttaccccctaattgatcaacatttctcaaaacatatgtacatatgtaactcttgtatctaagttatgtggaagcaag 21408806  T
499 agagaaaaagatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    ||||||||| ||||||| ||||||||| ||||||||||| ||||||||    
21408805 agagaaaaaaatgttttagatatttgtttgagttgtccgacacggctc 21408758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 310 - 535
Target Start/End: Complemental strand, 10516308 - 10516084
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||| || || |       | || |||||||    
10516308 taacttgagcaagttatttcattagaaaaagttctaaaataagatatcgtagtatttgaccattatttattcaactcctatcaaaaaggttaaaaatgtt 10516209  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga 509  Q
    ||||| |  | |||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||  |||||| |||||||||||| |    
10516208 ataataagctataatgtatattaccccctaattgattaacattttttaaaacatatgtaactcttgtatctacggtacatggaagtaagagagaaaaa-a 10516110  T
510 tgtttttgatatttgtctgagttgtc 535  Q
    | |||| ||||||||  |||||||||    
10516109 tattttagatatttgcatgagttgtc 10516084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 310 - 546
Target Start/End: Complemental strand, 10657580 - 10657344
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||| || ||||||||| |||||||||||||||||||||||||||||||  |||||||||||||||||||| || |||        | || |||||||    
10657580 taacttaagtaagttattttattagaaaaagttctaaaacaagatatcgtataatttgacctttatttattcaactcctt-caaaaaagttaaaaatgtt 10657482  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagaga-aaaag 508  Q
    |||||||  |||||||| | ||| || ||||||||||||||||||||||||||||||||| |||||||||||| |||  |||||| |||||||| ||||     
10657481 ataatcatatgtaatgtattttagcctctaattgatcaacatttttcaaaacatatgtaaatcttgtatctacggtacatggaagtaagagagaaaaaaa 10657382  T
509 atgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    || |||| ||||||| | ||||||||| | ||||||||    
10657381 atattttagatatttatatgagttgtctgacacggctc 10657344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 398 - 546
Target Start/End: Original strand, 26565408 - 26565556
Alignment:
398 gctagaaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaa 497  Q
    |||| |||||||||||| || ||||||||||||||| |||||| |||||||||||| | |||||||||||||||||| ||||||   |||||||||||||    
26565408 gctaaaaatgttataattaactgtaatgtctattactccctaaatgatcaacatttctaaaaacatatgtaactcttatatctaagatatgtggaagcaa 26565507  T
498 gagagaaaaagatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    |||||||||| ||||||| ||||||||||||||||||||| ||||||||    
26565508 gagagaaaaaaatgttttagatatttgtctgagttgtccgacacggctc 26565556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 403 - 515
Target Start/End: Original strand, 14218512 - 14218624
Alignment:
403 aaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag 502  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||| ||||| |||||||||||||||||||    
14218512 aaatgttataatcaactgtaatgtctattaccccctaattgatcaacatttatcaaaatatatgtgactcttgtgtctacggtatgtggaagcaagagag 14218611  T
503 aaaaagatgtttt 515  Q
    ||||| |||||||    
14218612 aaaaaaatgtttt 14218624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 306 - 482
Target Start/End: Original strand, 27063756 - 27063932
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||  ||||||| ||| |||| |||||||||||||||| | |||||| ||||||||||||||||||||||| |       |||| |||    
27063756 catctaacttgagcagtttatttctttaaaaaacgttctaaaacaagataccataatatatgacctttatttattcatctactgtcataaaagctaaaaa 27063855  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctac 482  Q
    |||| |||| || |  ||| ||||| || ||  ||||||||||||||| |||| | ||||||||||||| |||||||    
27063856 tgttgtaattaacttaaatttctataactcctaaattgatcaacatttctcaacatatatgtaactcttatatctac 27063932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 421 - 507
Target Start/End: Original strand, 49861100 - 49861186
Alignment:
421 taatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaa 507  Q
    |||||||||| |||||||||||||||||||| | ||||||| |||||||||||||||||||| || ||| |||||||||||| ||||    
49861100 taatgtctatgaccccctaattgatcaacatatctcaaaacttatgtaactcttgtatctacggtgtgtagaagcaagagaggaaaa 49861186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 409 - 514
Target Start/End: Complemental strand, 27109776 - 27109671
Alignment:
409 tataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaag 508  Q
    ||||||||| | |||||||||  ||||||||   |||||| |  |||||||||||||||||||||||||| ||| || |||||||||||||||||||||     
27109776 tataatcaactataatgtctacaaccccctatcagatcaaaaaatttcaaaacatatgtaactcttgtatttacggtgtgtggaagcaagagagaaaaaa 27109677  T
509 atgttt 514  Q
    ||||||    
27109676 atgttt 27109671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 307 - 388
Target Start/End: Complemental strand, 2227366 - 2227285
Alignment:
307 atctaacttgagcaagttatttcatta-gaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||||||||||| || | |||||| |||||||||||| |||||||| || || |||||||||||||||||||||||||||    
2227366 atctaacttgagcaa-ttgtgtcattaagaaaaagttctacaacaagatgtcatagtatttgacctttatttattcatctact 2227285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 421 - 507
Target Start/End: Complemental strand, 27109366 - 27109280
Alignment:
421 taatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaa 507  Q
    |||||||||  |||| ||||||||||||||| |  ||||||||||||||| ||||||| ||| || ||| |||||||||||||||||    
27109366 taatgtctacaacccactaattgatcaacatatcacaaaacatatgtaacccttgtatttacggtgtgtagaagcaagagagaaaaa 27109280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 155 - 241
Target Start/End: Complemental strand, 43922239 - 43922153
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacac 241  Q
    ||||||||||||||||| ||| || | |||| ||| ||  || |||||||||||||||||||||||||||  |||||||||||||||    
43922239 aagcatggactccgacacagatacctgacacgacactgacacggacacttcgacaccgctagtgtaaaaaatataggacaccgacac 43922153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 536
Target Start/End: Complemental strand, 17715979 - 17715758
Alignment:
318 gcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnn-gctagaaatgttataatca 416  Q
    |||| |||||| |||  |||| ||||||||||||||||   ||| |||||||||||||||||||||||| | |        || | |||  || ||||||    
17715979 gcaatttatttaattgaaaaaggttctaaaacaagatacgataaaatttgacctttatttattcatctattataaaaaaaagccaaaaacattgtaatca 17715880  T
417 attgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaa--aaagatgttt 514  Q
    | | |||| ||||| ||||| ||||||||  |||||| |||| |||||||||||||||||||| ||    ||||||| ||||||||||  ||| ||||||    
17715879 actttaatttctataaccccataattgatacacatttatcaacacatatgtaactcttgtatcgacgaagtgtggaaccaagagagaaataaaaatgttt 17715780  T
515 ttgatatttgtctgagttgtcc 536  Q
      || |||||| ||||||||||    
17715779 cagacatttgtttgagttgtcc 17715758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 536
Target Start/End: Complemental strand, 19017208 - 19016987
Alignment:
318 gcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnn-gctagaaatgttataatca 416  Q
    |||| |||||| |||  |||| ||||||||||||||||   ||| |||||||||||||||||||||||| | |        || | |||  || ||||||    
19017208 gcaatttatttaattgaaaaaggttctaaaacaagatacgataaaatttgacctttatttattcatctattataaaaaaaagccaaaaacattgtaatca 19017109  T
417 attgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaa--aaagatgttt 514  Q
    | | |||| ||||| ||||| ||||||||  |||||| |||| |||||||||||||||||||| ||    ||||||| ||||||||||  ||| ||||||    
19017108 actttaatttctataaccccataattgatacacatttatcaacacatatgtaactcttgtatcgacgaagtgtggaaccaagagagaaataaaaatgttt 19017009  T
515 ttgatatttgtctgagttgtcc 536  Q
      || |||||| ||||||||||    
19017008 cagacatttgtttgagttgtcc 19016987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 27109424 - 27109378
Alignment:
342 tctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||| |||||| |||||||| ||||||||||||||||||    
27109424 tctaaaacaagaaatcgtagtatttgacatttatttattcatctact 27109378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 27109822 - 27109776
Alignment:
342 tctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||||||||||| ||| ||||||| |||||||||||||||||||    
27109822 tctaaaacaagatattgtagtatttgatctttatttattcatctact 27109776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 335 - 388
Target Start/End: Original strand, 49860462 - 49860515
Alignment:
335 aaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||||||||| ||  |||||||| |||||||||| |||||||    
49860462 aaaaagttctaaaacaagatatagtggtatttgacatttatttatttatctact 49860515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 195 - 247
Target Start/End: Original strand, 11410589 - 11410641
Alignment:
195 acagacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    |||||||||| ||||||||||||||||||   ||||||||||||||| |||||    
11410589 acagacactttgacaccgctagtgtaaaatatataggacaccgacaccgctac 11410641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 145
Target Start/End: Original strand, 10540871 - 10540907
Alignment:
109 tgagcaggtatagtcacaattatctcagtagatgtga 145  Q
    ||||||||||||||||||||| ||||| |||||||||    
10540871 tgagcaggtatagtcacaattgtctcactagatgtga 10540907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 159 - 247
Target Start/End: Original strand, 14218323 - 14218411
Alignment:
159 atggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    |||||||||||||| ||||| | |||| | |||| || |||||||||| ||| | ||||||||||   ||||||| | |||||||||||    
14218323 atggactccgacattgacaccttacacaatattgatatagacacttcggcactgttagtgtaaaagatataggactctgacactgctac 14218411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 136; Significance: 1e-70; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 306 - 546
Target Start/End: Original strand, 17732789 - 17733032
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgaccttt-atttattcatctactttnnnnnnngctagaa 404  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||| |       |||| ||    
17732789 catctaacttgagcaagttatttcattagaaaaagttctaaagcaagatatcgtagtatttgaccttttatttattcatctactatcaaaaaagctaaaa 17732888  T
405 atgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag-- 502  Q
    ||||||||||||| |||||||||||||||| ||||||| |||||||||| |||||||| |||||||||||||||||||  ||||||||||||||||||      
17732889 atgttataatcaactgtaatgtctattacctcctaattaatcaacatttctcaaaacacatgtaactcttgtatctacgatatgtggaagcaagagagaa 17732988  T
503 aaaaagatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    ||||| ||||||   ||||||||| |||||||||| ||||||||    
17732989 aaaaaaatgtttcatatatttgtcagagttgtccgacacggctc 17733032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 323 - 523
Target Start/End: Original strand, 31734528 - 31734725
Alignment:
323 ttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgttataatcaattgta 422  Q
    |||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||| |       |||| ||||||||||||||| | ||    
31734528 ttatttcattagaaaaagttctaaaacaagatatcgtagtatttt-cctttatttattcatctactatcaaaagagctaaaaatgttataatcaactata 31734626  T
423 atgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaagatgtttttgatatt 522  Q
    |||||||||||||| |   |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| | ||| ||||||| ||||||    
31734627 atgtctattaccccatg--tgatcaacatttctcaaaacatatgtaactcttgtatctacggtatgtggaagcaagagaaagaaaaatgttttagatatt 31734724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 310 - 537
Target Start/End: Complemental strand, 40289294 - 40289069
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||||  ||| ||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||| |        ||| ||||       
40289294 taacttggacaatttatttcattagaaaaagttctacaacaagatatcatagtatttgacctttatttattcatctactatcaaaaaaactaaaaataac 40289195  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga 509  Q
     |||||||||||||||||||  ||||| |||||||| ||||||| ||||||||||||||| |||||||||||  || ||||||||||||||||||||| |    
40289194 ttaatcaattgtaatgtctacaacccc-taattgattaacatttctcaaaacatatgtaaatcttgtatctatggtgtgtggaagcaagagagaaaaa-a 40289097  T
510 tgtttttgatatttgtctgagttgtccg 537  Q
    |||||| ||||||||| |||||||||||    
40289096 tgttttagatatttgtttgagttgtccg 40289069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 306 - 542
Target Start/End: Complemental strand, 45612581 - 45612347
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||| ||||||||||| |||| ||||||||||| |||||| ||||||||||     ||||||||||||||||||||||||||| |       |||| |||    
45612581 catccaacttgagcaatttatgtcattagaaaatgttctacaacaagatat-----tatttgacctttatttattcatctactatcaaaaaagctaaaaa 45612487  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaa-catatgtaactcttgtatctacagtatgtggaagcaagagagaa 504  Q
    || ||||||||| | |||||||||| | ||| || || |||||||||| |||||| |||||||||||||||||||||  || || |||||||||||||||    
45612486 tgatataatcaactataatgtctataaaccctta-ttaatcaacatttctcaaaaacatatgtaactcttgtatctatggtgtgcggaagcaagagagaa 45612388  T
505 aaaga---tgtttttgatatttgtctgagttgtccgtcacg 542  Q
    ||| |   |||||| ||||||||| ||||||||||| ||||    
45612387 aaaaaaattgttttagatatttgtttgagttgtccgacacg 45612347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 310 - 386
Target Start/End: Original strand, 54305676 - 54305752
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatcta 386  Q
    |||||||||||| |||||| ||||||||||||||||  |||||||||| || |||||||||||||||||||||||||    
54305676 taacttgagcaatttatttaattagaaaaagttctacgacaagatatcatagtatttgacctttatttattcatcta 54305752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 409 - 482
Target Start/End: Original strand, 3419971 - 3420043
Alignment:
409 tataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctac 482  Q
    ||||||||| | |||| ||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||    
3419971 tataatcaactataatatctataacccc-taattgatcaacatttctcaaaacatatgtaactcttgtatctac 3420043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 438 - 507
Target Start/End: Complemental strand, 658493 - 658424
Alignment:
438 taattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaa 507  Q
    |||||| |||||||||||||  ||||||||||||||||| ||||| || ||||||| ||||||| |||||    
658493 taattgttcaacatttttcagcacatatgtaactcttgtttctacggtgtgtggaaccaagagacaaaaa 658424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 314 - 388
Target Start/End: Original strand, 2641164 - 2641238
Alignment:
314 ttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||| ||||||||||  ||||||||||||||||| |||   |  ||||||||||||||||||| |||||||    
2641164 ttgagcaacttatttcattgaaaaaagttctaaaacaaaatactatggtatttgacctttatttatttatctact 2641238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 306 - 375
Target Start/End: Original strand, 55680753 - 55680822
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttat 375  Q
    ||||||||| |||||| || | |||| ||||||||||||| ||||||||||| || |||||||| |||||    
55680753 catctaactcgagcaatttctgtcatcagaaaaagttctacaacaagatatcatagtatttgacatttat 55680822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 385
Target Start/End: Original strand, 44507704 - 44507782
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatct 385  Q
    ||||||| ||||| || ||||||||||| ||||| ||||||||||| ||||  | | ||||||||||||||||| |||||    
44507704 catctaatttgagaaatttatttcattaaaaaaa-ttctaaaacaaaatatgatgacatttgacctttatttatccatct 44507782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 155 - 247
Target Start/End: Original strand, 54305522 - 54305614
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    ||||||||||||| |||  ||||| | |||| ||| ||  || ||||| |||||| ||||| ||||||||  ||||||||||||||| |||||    
54305522 aagcatggactccaacacggacacctgacacaacactgacacggacacgtcgacatcgctaatgtaaaaattataggacaccgacaccgctac 54305614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 115; Significance: 4e-58; HSPs: 15)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 310 - 533
Target Start/End: Complemental strand, 1255804 - 1255581
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||  |||| || |       |||| |||||||    
1255804 taacttgagcaagttattttattagaaaaagttctaaaacaagatatcgtagtatttgacatttatttatgtatctgctatcaaaaaagctaaaaatgtt 1255705  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga 509  Q
    |||||||| |||||||||||| |||||||||||||||||||||  ||||||| |||||| ||||||||||||   | ||||||||||||||||||||| |    
1255704 ataatcaactgtaatgtctataaccccctaattgatcaacattcctcaaaacctatgtagctcttgtatctattatttgtggaagcaagagagaaaaata 1255605  T
510 tgtttttgatatttgtctgagttg 533  Q
       |||||||||||||||||||||    
1255604 atgttttgatatttgtctgagttg 1255581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 306 - 507
Target Start/End: Original strand, 12843919 - 12844119
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||||||||||||  ||||||||||||| |||||||| || |||||||| || ||||||||||||||||||||||||||| |       |||| |||    
12843919 catctaacttgagcaatatatttcattagaacaagttctacaataagatatcatagtatttgacctttatttattcatctactatcaaaaaagctaaaaa 12844018  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    || ||||||||| | |||||| ||| ||||| |||||||||||||||| |||||||||||||||||||||||||||  ||  ||||||||||||||||||    
12844019 tgatataatcaactataatgtgtataacccc-taattgatcaacatttctcaaaacatatgtaactcttgtatctatggtgcgtggaagcaagagagaaa 12844117  T
506 aa 507  Q
    ||    
12844118 aa 12844119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 306 - 548
Target Start/End: Original strand, 17540033 - 17540275
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||||||| |||| ||||  ||||||||||||||||  || |||||||| || ||||||||||||||||||| ||||||| |       |||| |||    
17540033 catctaacttgggcaatttatgacattagaaaaagttctgcaataagatatcatagtatttgacctttatttatttatctactatcaaaaaagctaaaaa 17540132  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    || ||||||||| | |||  | ||| ||||| |||||||||||||||| |||||||||||||||||||||||||||  || || ||||||||||||||||    
17540133 tgatataatcaactataacttttataacccc-taattgatcaacatttctcaaaacatatgtaactcttgtatctatggtgtgcggaagcaagagagaaa 17540231  T
506 aaga-tgtttttgatatttgtctgagttgtccgtcacggctcat 548  Q
    || | |||||| ||||||||||||||||||||| ||||| ||||    
17540232 aaaattgttttagatatttgtctgagttgtccgacacggttcat 17540275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 306 - 546
Target Start/End: Complemental strand, 14494585 - 14494345
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||| ||| ||||| ||||||||||||||||||||||| ||||| ||||| || |||||||||||||||||||| |||| | |       | || |||    
14494585 catctatctttagcaatttatttcattagaaaaagttctacaacaaaatatcatagtatttgacctttatttattcgtctattatcaaaaaagttaaaaa 14494486  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    || ||||||||| | | |||||||| ||||| |||||||||||||||| ||||||||||||||| |||||||||||  || ||||||| ||| |||||||    
14494485 tgatataatcaactatgatgtctataacccc-taattgatcaacatttctcaaaacatatgtaattcttgtatctatggtgtgtggaaacaatagagaaa 14494387  T
506 a-agatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    | |  |||||  ||||||||| ||||||||||| ||||||||    
14494386 acaattgtttaagatatttgtgtgagttgtccgacacggctc 14494345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 403 - 546
Target Start/End: Original strand, 57109 - 57253
Alignment:
403 aaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag 502  Q
    ||||||||||||||| | |||||||||| |||| ||| ||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||    
57109 aaatgttataatcaactttaatgtctataaccctctagttgatcaacatttctccaaacatatgtaactcttgtatctacggtatgtggaagcaagagag 57208  T
503 aaaaa-gatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    |||||  ||  ||| ||||||| ||| ||||||||| ||||||||    
57209 aaaaataataatttagatatttatcttagttgtccgacacggctc 57253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 306 - 525
Target Start/End: Original strand, 19542154 - 19542373
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||||||||  || | |||||||| |||||| ||||||||||| ||||| || |||||| |||||||||||||||||||| |       |||| ||     
19542154 catctaacttgaaaaattgatttcattggaaaaaattctaaaacaaaatatcttagtatttgtcctttatttattcatctactatcaagaatgctaaaat 19542253  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagt-atgtggaagcaagagagaa 504  Q
    |||||||||||| | |||| ||| | ||||  |||||| |||| |||| |||||||| ||||||||||||||| ||| || |||||||||||||||||||    
19542254 tgttataatcaactttaatatctctaaccct-taattgttcaatatttctcaaaacaaatgtaactcttgtatgtacggttatgtggaagcaagagagaa 19542352  T
505 aaagatgtttttgatatttgt 525  Q
    ||| ||||||| |||| ||||    
19542353 aaaaatgttttagatagttgt 19542373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 34708944 - 34709026
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||||||||| || ||||||||||||||||||||||  ||||||||||| || |||||||||||||||||||||||||||    
34708944 catctaacttgagaaatttatttcattagaaaaagttctccaacaagatatcatagtatttgacctttatttattcatctact 34709026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 19294401 - 19294480
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||| ||||| |||||||||||||||||||||   ||||||||||| || |||||||||||||||||||||||||||    
19294401 catctaacttaagcaatttatttcattagaaaaagttc---aacaagatatcatagtatttgacctttatttattcatctact 19294480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 403 - 507
Target Start/End: Original strand, 34709065 - 34709168
Alignment:
403 aaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag 502  Q
    ||||| ||||||||| | |||||| ||| ||||| ||||||||||||||||||||||| |||| |||||||| ||||||  |  |||| |||||||||||    
34709065 aaatgatataatcaactataatgtatataacccc-taattgatcaacatttttcaaaatatatataactcttatatctatggcgtgtgaaagcaagagag 34709163  T
503 aaaaa 507  Q
    |||||    
34709164 aaaaa 34709168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 378
Target Start/End: Complemental strand, 34011297 - 34011225
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttattta 378  Q
    ||||||||| |||||| |||| |||| | ||||||||||| ||||||||||| || |||||||| ||||||||    
34011297 catctaactcgagcaatttatgtcatcataaaaagttctacaacaagatatcatagtatttgacatttattta 34011225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 306 - 378
Target Start/End: Original strand, 34013553 - 34013625
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttattta 378  Q
    ||||||||| |||||| |||| |||| | ||||||||||| ||||||||||| || |||||||| ||||||||    
34013553 catctaactcgagcaatttatgtcatcataaaaagttctacaacaagatatcatagtatttgacatttattta 34013625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 356
Target Start/End: Original strand, 57024 - 57074
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatat 356  Q
    |||||||||||||||| |||||||||||||||| ||||||| | |||||||    
57024 catctaacttgagcaacttatttcattagaaaatgttctaatataagatat 57074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 388
Target Start/End: Complemental strand, 33234999 - 33234919
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| ||||||||||| |||||||| || |||||||||   || ||||||||| |||||||| ||||||||    
33234999 catctaacttgagcaatttatttcatta-aaaaagttttataacaagatacaatagtatttgacc-ttatttatccatctact 33234919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 499
Target Start/End: Complemental strand, 34011219 - 34011158
Alignment:
438 taattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaaga 499  Q
    |||||||||| ||||| ||||||||| || ||||||||||||||  || || ||||||||||    
34011219 taattgatcaccatttctcaaaacatgtgcaactcttgtatctatggtgtgcggaagcaaga 34011158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 438 - 499
Target Start/End: Original strand, 34013631 - 34013692
Alignment:
438 taattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaaga 499  Q
    |||||||||| ||||| ||||||||| || ||||||||||||||  || || ||||||||||    
34013631 taattgatcaccatttctcaaaacatgtgcaactcttgtatctatggtgtgcggaagcaaga 34013692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 306 - 542
Target Start/End: Complemental strand, 37338909 - 37338675
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||| |||||||||||||||| ||| | |||||||||||| || ||||||||||||||||||||||||||| |       | || |||    
37338909 catctaacttgagcaaattatttcattagaaaatgttatcaaacaagatatcatagtatttgacctttatttattcatctactatcaaaaaagttaaaaa 37338810  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    |||||| ||||| | |||||| ||  | ||| |||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||    
37338809 tgttattatcaactttaatgtttaaaatccc-taattgatcaacatttctcaaagcatatgtaactcttgtatctacggtatgtggaagcaagagagaaa 37338711  T
506 aagatgtttttgatatttgtctgagttgtccgtcacg 542  Q
    || ||||||  ||||||||||||||||||| ||||||    
37338710 aa-atgtttcagatatttgtctgagttgtctgtcacg 37338675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 306 - 533
Target Start/End: Original strand, 46532870 - 46533097
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||||||||| ||||||||||||| ||||||||||||||| |||||| |||| ||||||||| || |||||||| || || |       |||| |||    
46532870 catctaacttgaggaagttatttcatttgaaaaagttctaaaataagataacgtagtatttgaccattgtttattcacctgctgtcaaaaaagctaaaaa 46532969  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    ||||||||||||||||||||| ||| ||||| |||||||||||||||  |||||| ||||||| ||||||||||||   | |||| ||||||||||||||    
46532970 tgttataatcaattgtaatgtttataacccc-taattgatcaacattcctcaaaatatatgtagctcttgtatctatgatttgtgtaagcaagagagaaa 46533068  T
506 aaga-tgtttttgatatttgtctgagttg 533  Q
    || | |||||  ||||||||||| |||||    
46533069 aaaactgtttcagatatttgtctaagttg 46533097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 306 - 545
Target Start/End: Original strand, 27616341 - 27616569
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||| |||||||||  |||||| ||||||| |||||||||||||||||||| || |||||||| ||||||||| |||||||| |       |||| |||    
27616341 catcttacttgagcagtttatttaattagaacaagttctaaaacaagatatcatagtatttgacttttatttatacatctactatcagaaaagctaaaaa 27616440  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    |||||||||||| | |||||||||| ||||||||||||| || ||||| ||           |||||||||||||||    |||||||||||||||||||    
27616441 tgttataatcaactttaatgtctataaccccctaattgaccatcatttctc-----------aactcttgtatctacgacgtgtggaagcaagagagaaa 27616529  T
506 aagatgtttttgatatttgtctgagttgtccgtcacggct 545  Q
    || ||||||  ||||||||||||||||||||| |||||||    
27616530 aaaatgtttcagatatttgtctgagttgtccgacacggct 27616569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 434 - 535
Target Start/End: Original strand, 10678436 - 10678536
Alignment:
434 cccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaagatgtttttgatatttgtctgagttg 533  Q
    ||||||||||||||| |||| |||||||||| ||||||||||||||||| |||||||||||||||||| ||| | ||| |||  ||||||||||||||||    
10678436 cccctaattgatcaatatttctcaaaacatacgtaactcttgtatctacggtatgtggaagcaagagaaaaagaaatg-tttaaatatttgtctgagttg 10678534  T
534 tc 535  Q
    ||    
10678535 tc 10678536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 309 - 388
Target Start/End: Complemental strand, 45216106 - 45216027
Alignment:
309 ctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||||||||| |||| |||||||||||||||||| || ||||| || || |||||||||||||||||||||||||||    
45216106 ctaacttgagcaatttatgtcattagaaaaagttctacaataagatgtcatattatttgacctttatttattcatctact 45216027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 310 - 388
Target Start/End: Original strand, 22290882 - 22290960
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||| | ||| ||||||||||| ||||||||||| ||||||||||| |  ||||||||||||||||||| |||||||    
22290882 taacttaaacaatttatttcattaaaaaaagttctacaacaagatatcattgtatttgacctttatttattaatctact 22290960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 487 - 537
Target Start/End: Complemental strand, 44572481 - 44572431
Alignment:
487 tgtggaagcaagagagaaaaagatgtttttgatatttgtctgagttgtccg 537  Q
    |||||||||||||||||||||  |||||| |||||||||||||||||||||    
44572481 tgtggaagcaagagagaaaaaattgttttagatatttgtctgagttgtccg 44572431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 436 - 527
Target Start/End: Complemental strand, 44182466 - 44182375
Alignment:
436 cctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaagatgtttttgatatttgtct 527  Q
    |||||||||| ||| ||| |||| | |||| ||| |||||||||||| || ||||||| ||||||||| ||| ||||||| || ||||||||    
44182466 cctaattgattaacttttctcaacatatatctaattcttgtatctacggtgtgtggaaccaagagagagaaaaatgttttagacatttgtct 44182375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 307 - 384
Target Start/End: Complemental strand, 32716658 - 32716581
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatc 384  Q
    |||||||||||  || || ||| |||| |||||||||||||||||||||   || ||||||| |||||||||||||||    
32716658 atctaacttgaataatttgttttattaaaaaaagttctaaaacaagatacaatagtatttgatctttatttattcatc 32716581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 155 - 224
Target Start/End: Complemental strand, 37339058 - 37338989
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaa 224  Q
    |||||||||||||||||||||||||| |||| | | | | ||| |||||| ||||||||||| |||||||    
37339058 aagcatggactccgacatagacacttgacacgatactagcacatacactttgacaccgctagggtaaaaa 37338989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 308 - 388
Target Start/End: Complemental strand, 11811058 - 11810979
Alignment:
308 tctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||| ||||||||||| ||||| || |  |||||||||   |||||||||||||||||| ||| |||||||    
11811058 tctaacttgagcaatttatttcatta-aaaaatttatctaacaagatacaataatatttgacctttattaatttatctact 11810979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 310 - 355
Target Start/End: Original strand, 27993922 - 27993967
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagata 355  Q
    |||||||||||| ||||||||||| | ||||||||| |||||||||    
27993922 taacttgagcaatttatttcattaaataaagttctataacaagata 27993967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 342 - 378
Target Start/End: Original strand, 10678399 - 10678435
Alignment:
342 tctaaaacaagatatcgtaatatttgacctttattta 378  Q
    ||||||||||||||||||| ||||||| |||||||||    
10678399 tctaaaacaagatatcgtagtatttgagctttattta 10678435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 195 - 247
Target Start/End: Complemental strand, 11812757 - 11812705
Alignment:
195 acagacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    |||||||| | |||||||||| ||||||||  ||||||||||||||| |||||    
11812757 acagacacgttgacaccgctaatgtaaaaaacataggacaccgacacagctac 11812705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 487 - 546
Target Start/End: Complemental strand, 45215989 - 45215927
Alignment:
487 tgtggaagcaagagagaaaaaga---tgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    ||||||||||||||||||||| |   |||||| |||||||| ||| |||||||| ||||||||    
45215989 tgtggaagcaagagagaaaaaaaaattgttttagatatttgactgggttgtccgacacggctc 45215927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 103; Significance: 5e-51; HSPs: 17)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 306 - 537
Target Start/End: Complemental strand, 18603203 - 18602985
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||| |||||||||||||||||||||||||| ||||||| ||||||||| ||||||| |||||||||   |               |||| |||    
18603203 catctaacttaagcaagttatttcattagaaaaagttttaaaacacgatatcgtagtatttgatctttatttaaaaa-------------aagctaaaaa 18603117  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatc-tacagtatgtggaagcaagagagaa 504  Q
    |||||||||||||||||||||| ||| | ||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||    
18603116 tgttataatcaattgtaatgtcaatt-caccctaattgatcaacatttctcaaaacatatgtaactcttgtatcataccgtatgtggaagcaagagagaa 18603018  T
505 aaagatgtttttgatatttgtctgagttgtccg 537  Q
    ||| ||| ||| |||||||||||||||||||||    
18603017 aaaaatgctttagatatttgtctgagttgtccg 18602985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 307 - 537
Target Start/End: Complemental strand, 15850601 - 15850382
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaat 406  Q
    |||||| |||||||| |||||||||||||||||||| ||||||||||||||  | |||||||| |||||||||||||||||| |       |||| ||||    
15850601 atctaatttgagcaaattatttcattagaaaaagttataaaacaagatatcacagtatttgacatttatttattcatctactatcaaaaaagctaaaaat 15850502  T
407 gttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaa 506  Q
    ||||||           ||||||| ||| || | |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
15850501 gttata-----------tgtctataacctcccagttgatcaacatttttcaaaacatatgtaactcttgtatctacggaatgtggaagcaagagagaaaa 15850413  T
507 agatgtttttgatatttgtctgagttgtccg 537  Q
    | || |||  |||||| |||| |||||||||    
15850412 aaatatttcagatattcgtcttagttgtccg 15850382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 310 - 529
Target Start/End: Original strand, 28421061 - 28421281
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||||||||| |||| ||||||||||||||| || ||||||||||| ||  |||||||||||||||||||||||||| |       |||| ||| | |    
28421061 taacttgagcaatttatgtcattagaaaaagttttacaacaagatatcatatgatttgacctttatttattcatctactatcaaaaaagctaaaaacgat 28421160  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga 509  Q
    |||||||| | ||||||||| || || |||||||||||| |||| |||||| ||||||||||||||||||||  || || |||||| ||||||||||| |    
28421161 ataatcaactataatgtcta-taaccactaattgatcaagatttctcaaaatatatgtaactcttgtatctatggtgtgcggaagcgagagagaaaaaaa 28421259  T
510 --tgtttttgatatttgtctga 529  Q
      |||||| |||||| ||||||    
28421260 attgttttagatattagtctga 28421281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 306 - 548
Target Start/End: Complemental strand, 15132113 - 15131870
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||| ||||| ||| | ||||||||||| | ||||||||| || ||||||| ||||||||||| ||||||| |       |||| |||    
15132113 catctaacttgagcaatttatt-catgataaaaagttctacagcaagatatcatagtatttgatctttatttatttatctactatcgaaaaagctaaaaa 15132015  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaa 505  Q
    || ||||||||| | |||||||||| ||||| ||||||||||| |||| | |||||||||||||||| |||||||   || ||  |||||||||||||||    
15132014 tgatataatcaactataatgtctataacccc-taattgatcaatatttctaaaaacatatgtaactcctgtatctctggtgtgcagaagcaagagagaaa 15131916  T
506 aaga---tgtttttgatatttgtctgagttgtccgtcacggctcat 548  Q
    || |   |  ||| |||||||||||||||||| || ||| ||||||    
15131915 aaaaaaattgtttagatatttgtctgagttgttcgacactgctcat 15131870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 310 - 469
Target Start/End: Original strand, 44502311 - 44502469
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||||||||| ||||||||| | ||||||||||| ||||||||||| || |||||||||||||||||||||||| || |       | || ||||  |    
44502311 taacttgagcaatttatttcatcataaaaagttctacaacaagatatcatactatttgacctttatttattcatctgctatcaaaaaagttaaaaataat 44502410  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaa 469  Q
    |||||||| | ||||||||| || ||||||||  |||||||||| |||||||||||||||    
44502411 ataatcaactataatgtcta-taacccctaatcaatcaacatttctcaaaacatatgtaa 44502469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 317 - 534
Target Start/End: Original strand, 1226083 - 1226300
Alignment:
317 agcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgttataatca 416  Q
    ||||| ||||||||||  |||||||| |||||||||||| |  | ||||||| ||||||||||||||||||| |         || ||||||| ||||||    
1226083 agcaatttatttcattgaaaaaagttataaaacaagataccagagtatttgatctttatttattcatctactatcaaaaatt-taaaaatgttgtaatca 1226181  T
417 attgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagaga-aaaagatgtttt 515  Q
    | | |||| ||||| | || ||||||||| ||||||| |||| |||||| ||||||||||||||||  | |||||||  |||||||| |||| || |||     
1226182 actttaatttctataaacctctaattgattaacatttctcaacacatatttaactcttgtatctacgatgtgtggaataaagagagagaaaaaatatttc 1226281  T
516 tgatatttgtctgagttgt 534  Q
      |||||||||||||||||    
1226282 aaatatttgtctgagttgt 1226300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 27401839 - 27401921
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| ||||||||||| |||||||| || |||||||||   ||  ||||| ||||||||||| ||||||||    
27401839 catctaacttgagcaatttatttcattaaaaaaagttatataacaagatacaatagaatttggcctttatttatccatctact 27401921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 37855176 - 37855258
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||| ||||| || ||||||||| |||||||||| |  ||||||||||  || ||||| |||||||||||||||||||||    
37855176 catctaatttgagaaatttatttcatgagaaaaagttatgcaacaagatataatagtatttaacctttatttattcatctact 37855258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 388
Target Start/End: Complemental strand, 2889879 - 2889798
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||| |||||||||| ||||||||||| |||||| |||| |||||||||   || |||||| ||||||||||| ||||||||    
2889879 atcttacttgagcaatttatttcattaaaaaaaggtctataacaagatacaatagtatttggcctttatttatccatctact 2889798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 388
Target Start/End: Original strand, 3145256 - 3145337
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||| |||||||||| ||||||||||| |||||| |||| |||||||||   || |||||| ||||||||||| ||||||||    
3145256 atcttacttgagcaatttatttcattaaaaaaaggtctataacaagatacaatagtatttggcctttatttatccatctact 3145337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 307 - 386
Target Start/End: Original strand, 3159848 - 3159927
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatcta 386  Q
    ||||||||||||||| ||||||||||| |||||| |||| |||||| ||   || |||||| ||||||||||| ||||||    
3159848 atctaacttgagcaatttatttcattaaaaaaaggtctataacaagttacaatagtatttggcctttatttatccatcta 3159927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 310 - 388
Target Start/End: Complemental strand, 18393693 - 18393615
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||| ||| |||||| |||| |||||||| || |||||||||   || |||||||||||||||||| ||||||||    
18393693 taacttgaacaatttattttattaaaaaaagttttataacaagataaaatagtatttgacctttatttatccatctact 18393615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 155 - 237
Target Start/End: Complemental strand, 18603353 - 18603271
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccg 237  Q
    ||||||||||||||||| |||||| | | ||   ||||  |||||||||||||||||| |||||||||||  |||||||||||    
18603353 aagcatggactccgacacagacacctgatacagtattgacacagacacttcgacaccgttagtgtaaaaaatataggacaccg 18603271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 307 - 388
Target Start/End: Complemental strand, 2875524 - 2875443
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    ||||||||||||||| ||| ||||||| |||||| | || |||||||||   || |||||| ||||||||||| ||||||||    
2875524 atctaacttgagcaatttagttcattaaaaaaaggtttataacaagatacaatagtatttggcctttatttatccatctact 2875443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 158 - 241
Target Start/End: Complemental strand, 15850749 - 15850666
Alignment:
158 catggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacac 241  Q
    ||||||||||||||  ||||| | |||| ||| || ||  ||||||||||||| | |||||||||||  |||||||||||||||    
15850749 catggactccgacacggacacctgacacgacactgatatggacacttcgacactgttagtgtaaaaaatataggacaccgacac 15850666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 3159758 - 3159798
Alignment:
207 acaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    ||||||||| ||||||||  |||||||||||||||||||||    
3159758 acaccgctaatgtaaaaaacataggacaccgacactgctac 3159798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 155 - 243
Target Start/End: Original strand, 44502157 - 44502245
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacactg 243  Q
    ||||||||| ||||| |  ||||| |||||| ||| || ||||||| | ||||||  |||| ||||||||  |||||||||||||||||    
44502157 aagcatggattccgatacggacacctaacacgacactgatacagacgcgtcgacattgctaatgtaaaaaatataggacaccgacactg 44502245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 101; Significance: 8e-50; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 306 - 546
Target Start/End: Original strand, 26576077 - 26576319
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||| |||| |||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||| |       |||| |||    
26576077 catctaacttgagcaatttatgtcattagaaaaagttctacaacaagatatcatagtatttgacctttatttattcatctactatcaaataagctaaaaa 26576176  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag--- 502  Q
     | ||||||||| | ||||||||| || || ||||| ||||||||||| |||||||||||||||||||||||||||  || || |||||||||||||       
26576177 cgatataatcaactataatgtcta-taaccactaatcgatcaacatttctcaaaacatatgtaactcttgtatctatggtgtgcggaagcaagagagaga 26576275  T
503 aaaaagatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    |||||  ||||||  |||||||| ||||||||||| ||||||||    
26576276 aaaaatttgttttaaatatttgtttgagttgtccgacacggctc 26576319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 306 - 534
Target Start/End: Complemental strand, 34409727 - 34409500
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnn-gctagaa 404  Q
    |||||||||||||||| ||| | ||||||||||||||||| ||||||||||  || ||||||||||||||||||| ||||||  |        |||| ||    
34409727 catctaacttgagcaatttagt-cattagaaaaagttctacaacaagatattatagtatttgacctttatttatttatctaccgtcagaaaaagctaaaa 34409629  T
405 atgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaa 504  Q
    ||| ||||||||| | |||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||  || || |||| |||||||||     
34409628 atgatataatcaactataatgtctataacccc-taattgatcaacatttctcaaaacatatgtaactcttgtatctatggtgtgcggaatcaagagagag 34409530  T
505 aaagatgtttttgatatttgtctgagttgt 534  Q
    |||  |||||| |||| |||| ||||||||    
34409529 aaaattgttttagatagttgtttgagttgt 34409500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 306 - 507
Target Start/End: Original strand, 9929647 - 9929865
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    ||||||| |||||||| ||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||| |       |||  |||    
9929647 catctaatttgagcaatttatttcattagaaaaagttctacaacaagatatcatagtatttgacctttatttattcatctactatcaaaaatgctcaaaa 9929746  T
406 tgttataatcaattgtaatgtctat-----------------taccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatg 488  Q
    || ||| ||||| ||||||||||||                 || |||||| ||||||||||||| |||||||||||||||||||||||||||  || ||    
9929747 tgatatgatcaactgtaatgtctataacccctgtaatgtctataacccctatttgatcaacatttctcaaaacatatgtaactcttgtatctatggtgtg 9929846  T
489 tggaagcaagagagaaaaa 507  Q
    ||||||||||| |||||||    
9929847 tggaagcaagatagaaaaa 9929865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 306 - 507
Target Start/End: Original strand, 27004051 - 27004254
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctacttt---nnnnnnngctag 402  Q
    ||||||||||||| || ||||||||||| ||||||||||  ||||||||||| || ||||||||||||||||||||||||||| |           |||     
27004051 catctaacttgagaaatttatttcattaaaaaaagttctccaacaagatatcatagtatttgacctttatttattcatctactgtaaaaaaaaaaactaa 27004150  T
403 aaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag 502  Q
    ||||| ||||||||| | ||||||  | || ||||||||||||||||||||||||||||||||  ||||||||||||||  | ||||| |||||| ||||    
27004151 aaatgatataatcaactataatgtaca-taacccctaattgatcaacatttttcaaaacatatacaactcttgtatctatggcatgtgaaagcaaaagag 27004249  T
503 aaaaa 507  Q
    |||||    
27004250 aaaaa 27004254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 314 - 537
Target Start/End: Complemental strand, 44650106 - 44649883
Alignment:
314 ttgagcaagttatttcatt-agaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgttata 412  Q
    |||||||| |||||||||| | ||||| || |||||||||||| | ||  |||||||||||||||||||||||||| |       | || ||||||| ||    
44650106 ttgagcaatttatttcattgaaaaaaaattataaaacaagataccatagaatttgacctttatttattcatctactatcaaaaaagttaaaaatgttgta 44650007  T
413 atcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagaga-aaaagatg 511  Q
    ||||| | |||| ||||| | ||||||||||||||||||||||||| |||||| |||||||  |||||||  | ||||||| ||||||||| |||| |||    
44650006 atcaactttaatttctataagcccctaattgatcaacatttttcaacacatatataactct--tatctacgttgtgtggaaccaagagagagaaaaaatg 44649909  T
512 tttttgatatttgtctgagttgtccg 537  Q
    || |  | ||||||||||||||||||    
44649908 ttctaaacatttgtctgagttgtccg 44649883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 308 - 537
Target Start/End: Complemental strand, 4748224 - 4747996
Alignment:
308 tctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatg 407  Q
    |||||||||||||| |||||||||| ||||||||||||||||||| ||   || |||||||||||||||||||||||| || |        ||| |||||    
4748224 tctaacttgagcaatttatttcattggaaaaagttctaaaacaagttacgatagtatttgacctttatttattcatcttctattgaacaaactaaaaatg 4748125  T
408 ttataatcaattgtaatgtctat-taccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaa 506  Q
     | ||||||| | |||||||| | || ||||| | |||||||||  ||||| |||| |||||||||||| |||||| || ||||||||||| || |||||    
4748124 ctgtaatcaactttaatgtctctataacccctcagtgatcaaca--tttcacaacacatgtaactcttggatctacggtgtgtggaagcaatagtgaaaa 4748027  T
507 agatgtttttgatatttgtctgagttgtccg 537  Q
    | | ||||  || |||||||| |||||||||    
4748026 aaaagtttcagacatttgtctcagttgtccg 4747996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 306 - 388
Target Start/End: Complemental strand, 32200969 - 32200887
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| |||| |||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||    
32200969 catctaacttgagcaatttatgtcattagaaaaagttctacaacaagatatcatagtatttgacctttatttattcatctact 32200887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 13037324 - 13037406
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| |||| ||||| |||||||||||| ||||||||||| || ||||||| |||||||||||||||||||    
13037324 catctaacttgagcaatttatgtcatttgaaaaagttctacaacaagatatcatagtatttgatctttatttattcatctact 13037406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 437 - 535
Target Start/End: Original strand, 13039025 - 13039124
Alignment:
437 ctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga-tgtttttgatatttgtctgagttgtc 535  Q
    ||||||||||||||||| ||| |||||||||||||||||||||||  || || |||||||||||| ||||| | |||||| |||||||||||||| ||||    
13039025 ctaattgatcaacatttctcataacatatgtaactcttgtatctatggtgtgcggaagcaagagataaaaaaattgttttagatatttgtctgagctgtc 13039124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 438 - 546
Target Start/End: Complemental strand, 32200857 - 32200747
Alignment:
438 taattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagca--agagagaaaaagatgtttttgatatttgtctgagttgtc 535  Q
    |||||||||| ||||| ||||||||||||||||||||||||| |  |  || |||||||  |||||||||||  |||||| ||||||| |||||||||||    
32200857 taattgatcagcatttctcaaaacatatgtaactcttgtatccatggcgtgcggaagcaagagagagaaaaaattgttttagatatttttctgagttgtc 32200758  T
536 cgtcacggctc 546  Q
    || ||||||||    
32200757 cgacacggctc 32200747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 17651275 - 17651357
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| ||||||||||| || |||||||| |||||| ||   ||||||||| ||||||||||| ||||||||    
17651275 catctaacttgagcaatttatttcattacaagaagttctataacaagttacaataatatttggcctttatttatccatctact 17651357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 307 - 376
Target Start/End: Complemental strand, 16661322 - 16661253
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatt 376  Q
    ||||||||||||||| |||||| |||| |||||||||||||||||||||   || ||||| |||||||||    
16661322 atctaacttgagcaatttattttattaaaaaaagttctaaaacaagataggatagtatttaacctttatt 16661253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 155 - 247
Target Start/End: Original strand, 9929497 - 9929589
Alignment:
155 aagcatggactccgacatagacacttaacactacattggtacagacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    ||||||||||| ||||| | |||||| |||| ||| ||  || ||||| |||||||||||| ||||||||  |||||||||| ||||||||||    
9929497 aagcatggactacgacacaaacacttgacacgacactgacacggacacgtcgacaccgctaatgtaaaaaatataggacaccaacactgctac 9929589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 421 - 504
Target Start/End: Complemental strand, 15990100 - 15990017
Alignment:
421 taatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaa 504  Q
    |||| ||||| |||||| ||||| ||||||||| |||| ||||||||||||||| |||||||  | ||||||  ||||||||||    
15990100 taatttctataacccccaaattggtcaacatttctcaacacatatgtaactcttatatctacgttgtgtggatccaagagagaa 15990017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 198 - 246
Target Start/End: Complemental strand, 4748312 - 4748264
Alignment:
198 gacacttcgacaccgctagtgtaaaaacaataggacaccgacactgcta 246  Q
    ||||| |||||||||||| ||||||||  ||||||||||||||||||||    
4748312 gacacatcgacaccgctaatgtaaaaaatataggacaccgacactgcta 4748264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 318 - 388
Target Start/End: Complemental strand, 38783744 - 38783674
Alignment:
318 gcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||| ||||||||||| |||||||| || |||||||||    |||||||||| ||||||||| ||||||||    
38783744 gcaatttatttcattaaaaaaagttttataacaagatacaacaatatttgacatttatttatccatctact 38783674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 198 - 246
Target Start/End: Original strand, 41848928 - 41848976
Alignment:
198 gacacttcgacaccgctagtgtaaaaacaataggacaccgacactgcta 246  Q
    ||||| |||||||||||| ||||||||  ||||||||||||||| ||||    
41848928 gacacatcgacaccgctaatgtaaaaaatataggacaccgacaccgcta 41848976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 99; Significance: 1e-48; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 314 - 534
Target Start/End: Complemental strand, 32676773 - 32676552
Alignment:
314 ttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgttataa 413  Q
    |||||||| |||||||||||||||||||| |||||||||||||| || ||||||| ||| ||||||||||||||| |       | || |||||||||||    
32676773 ttgagcaatttatttcattagaaaaagttataaaacaagatatcatattatttgatctt-atttattcatctactatcaaaaaagttaaaaatgttataa 32676675  T
414 tcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga--tg 511  Q
    |||| | ||||||||||  |||||||||||| |||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||| |  ||    
32676674 tcaactttaatgtctatatccccctaattgaacaacatttctcaaaacatatgtaactcttgtatttacaatgtgtggaagcaagagagaaaaaaacttg 32676575  T
512 tttttgatatttgtctgagttgt 534  Q
    |||  ||||||||||| ||||||    
32676574 tttaagatatttgtctaagttgt 32676552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 359 - 542
Target Start/End: Original strand, 40837972 - 40838153
Alignment:
359 taatatttgacctttatttattcatctactttnnnnnnngctagaaatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaa 458  Q
    |||||||||||||||||||||||||||||| |       |||| |||||||||||| || | |||||| ||||||||| |||||||||||||||| ||||    
40837972 taatatttgacctttatttattcatctactatcaaaaa-gctaaaaatgttataataaactataatgtttattacccc-taattgatcaacatttctcaa 40838069  T
459 aacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaagatgtttttgatatttgtctgagttgtccgtcacg 542  Q
    |||||||||||||||||||||||| |||| ||||||||||||  ||||| ||||||| || |||||||||||||||||| ||||    
40838070 aacatatgtaactcttgtatctacggtatctggaagcaagaggaaaaaaaatgttttagacatttgtctgagttgtccgacacg 40838153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 306 - 468
Target Start/End: Complemental strand, 38989396 - 38989237
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||| |||| |||||||||||||||||| ||||||||||| || |||||||| |||||||||||||||||| |         || |||    
38989396 catctaacttgagcaatttatgtcattagaaaaagttctacaacaagatatcatagtatttgacttttatttattcatctactatcaaaagatttaaaaa 38989297  T
406 tgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgta 468  Q
    || |||||||||   ||||||||| || |||||||||||||||||||| || |||||||||||    
38989296 tgatataatcaa--ataatgtcta-taacccctaattgatcaacatttatcgaaacatatgta 38989237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 306 - 373
Target Start/End: Original strand, 40837822 - 40837889
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgaccttt 373  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||    
40837822 catctaacttgagcaaattatttcattagaaaaagttctaaaacaagatattgtagtatttgaccttt 40837889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 32676887 - 32676838
Alignment:
198 gacacttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    ||||| |||||||||||| |||||||| |||||||||||||| |||||||    
32676887 gacacgtcgacaccgctaatgtaaaaaaaataggacaccgaccctgctac 32676838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 41815757 - 41815678
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatct 385  Q
    ||||||| |||||||| |||||| |||| ||||| ||||||||||| |||   | | ||||||||||||||||| |||||    
41815757 catctaatttgagcaaattatttaattaaaaaaaattctaaaacaaaataagatgacatttgacctttatttatccatct 41815678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 95; Significance: 3e-46; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 306 - 534
Target Start/End: Original strand, 32740866 - 32741091
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaa--tatttgacctttatttattcatctactttnnnnnnngctaga 403  Q
    |||||||||||||||| |||||| ||||||||||||||   ||||||||||| ||   ||||||||||||||||||||||||||  |       |||| |    
32740866 catctaacttgagcaatttatttaattagaaaaagttc---aacaagatatcatatagtatttgacctttatttattcatctaccatcaaaaaagctaaa 32740962  T
404 aatgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagaga 503  Q
    ||||  ||||||||||||||||||||| |||||| |||||||||||||||  ||||||||||||||||||||||||||  || |||||||||||||||||    
32740963 aatg--ataatcaattgtaatgtctataaccccc-aattgatcaacatttcacaaaacatatgtaactcttgtatctatggtgtgtggaagcaagagaga 32741059  T
504 aaaaga-tgtttttgatatttgtctgagttgt 534  Q
    |||| | |||||| |||||||| |||||||||    
32741060 aaaaaattgttttagatatttgcctgagttgt 32741091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 306 - 546
Target Start/End: Original strand, 23431883 - 23432126
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaa 405  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| || ||||||||||||||| |       | || |||    
23431883 catctaacttgagcaagttatttcattagaaaaagttctaaaacaaaatatcgtagtatttgacattcatttattcatctactatcaaaaaagttaaaaa 23431982  T
406 tgttataatcaattgtaa-------tgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaag 498  Q
    |||||||||| |  ||||       |||||||||||||||||||| || ||| || |||||||||||||||||||||||||| | ||||||||||  | |    
23431983 tgttataatctacggtaatgtctattgtctattaccccctaattgttc-acacttctcaaaacatatgtaactcttgtatcttctgtatgtggaa--atg 23432079  T
499 agagaaaaagatgtttttgatatttgtctgagttgtccgtcacggctc 546  Q
    ||||||||| ||||| | ||||||| ||||||||||||| ||||||||    
23432080 agagaaaaa-atgttctagatatttatctgagttgtccgacacggctc 23432126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 310 - 535
Target Start/End: Complemental strand, 48632725 - 48632501
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||||||||  ||||||||||  ||||||||||||||||||||| | || |||||||||||||||||||| |||||| |       |||| ||| |||    
48632725 taacttgagcagtttatttcattgaaaaaagttctaaaacaagataccatagtatttgacctttatttattcttctactatcaaaaaagctaaaaacgtt 48632626  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaaaga 509  Q
     ||||||| | |||| ||||| ||||| |||||||||||||||| |||| ||||||| ||||||||||||||| || ||| ||| ||||||| ||||| |    
48632625 gtaatcaactttaatttctataaccccgtaattgatcaacatttctcaacacatatgcaactcttgtatctacggtgtgtagaaccaagaga-aaaaaaa 48632527  T
510 tgtttttgatatttgtctgagttgtc 535  Q
    |||||  || |||||| |||||||||    
48632526 tgtttcagacatttgtttgagttgtc 48632501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 18476522 - 18476605
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacc-tttatttattcatctact 388  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||    
18476522 catctaacttgagcaagttatttcattagaaaaagttctaaagcaagatatcgtagtatttgaccttttatttattcatctact 18476605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 307 - 545
Target Start/End: Complemental strand, 9149143 - 9148908
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaat 406  Q
    |||||||||||| || |||||||||||||||||  | |||||||||||||| || ||||| ||||||||||||| ||||||| |       |||| ||||    
9149143 atctaacttgagaaatttatttcattagaaaaaagtttaaaacaagatatcatagtattttacctttatttatttatctactatcaaaaaagctaaaaat 9149044  T
407 gttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaaaa 506  Q
    ||||||  ||| | |||||||||| ||| || |||||||| |||||| |  || |||| |||||||||||||||||| | || |||||||||||| ||||    
9149043 gttatagccaactttaatgtctataaccacc-aattgatctacatttct-taatcatacgtaactcttgtatctacaatttgcggaagcaagagataaaa 9148946  T
507 agatgtttttgatatttgtctgagttgtccgtcacggct 545  Q
    | ||||||  | || ||| |||||||||||| |||||||    
9148945 aaatgtttcagtta-ttggctgagttgtccgacacggct 9148908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 419 - 546
Target Start/End: Original strand, 18488337 - 18488465
Alignment:
419 tgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagag-aaaaagatgtttttg 517  Q
    |||||||||||||||| || |||| |||||||||| |||||||| |||||||||||| ||||||  |||||||||||||||||| ||||| ||||||       
18488337 tgtaatgtctattacctccaaattaatcaacatttctcaaaacacatgtaactcttggatctacgatatgtggaagcaagagagaaaaaaaatgtttcat 18488436  T
518 atatttgtctgagttgtccgtcacggctc 546  Q
    ||||||||| |||||||||| || |||||    
18488437 atatttgtcagagttgtccgacatggctc 18488465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 362 - 473
Target Start/End: Original strand, 126324 - 126435
Alignment:
362 tatttgacctttatttattcatctactttnnnnnnngctagaaatgttataatcaattgtaatgtctattacccc-ctaattgatcaacatttttcaaaa 460  Q
    ||||||||||||||||||||||||||| |       | || ||||||||||||||| | |||||||||| ||||| ||||||||||||||||| ||||||    
126324 tatttgacctttatttattcatctactattaaaaa-gttaaaaatgttataatcaactttaatgtctataacccccctaattgatcaacatttctcaaaa 126422  T
461 catatgtaactct 473  Q
    |||||||||||||    
126423 catatgtaactct 126435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 306 - 482
Target Start/End: Complemental strand, 7021718 - 7021539
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact-ttnnnnnnngctagaa 404  Q
    ||||||||||| |||| |||||| |||  ||||||||||||||||| ||| |  || |||||||||||||||||| ||||||| |        || | ||    
7021718 catctaacttgcgcaatttattttattgaaaaaagttctaaaacaaaataccacaagatttgacctttatttatttatctactatcaaaaaaagccaaaa 7021619  T
405 atgttataatcaa--ttgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctac 482  Q
    ||||| |||||||  || |||| ||||| |||| |||||| |||||||||| |||| ||||||||||||||| |||||||    
7021618 atgttgtaatcaactttataatttctataacccgctaatttatcaacatttctcaacacatatgtaactcttatatctac 7021539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 388
Target Start/End: Original strand, 3954966 - 3955048
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||||||| ||||||||||| |||||||||||||| ||||||   |  |||||||||||||||||| ||||||||    
3954966 catctaacttgagcaatttatttcattaaaaaaagttctaaaataagatacgatcgtatttgacctttatttatccatctact 3955048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 387
Target Start/End: Original strand, 3387675 - 3387752
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctac 387  Q
    |||||||| ||| |||||| |||| ||||||||||| |||||||||   || ||||||||||||||||||||||||||    
3387675 taacttgaacaatttattttattaaaaaaagttctataacaagataaaatagtatttgacctttatttattcatctac 3387752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 307 - 369
Target Start/End: Original strand, 125194 - 125256
Alignment:
307 atctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgac 369  Q
    ||||||||||||||| ||||||||||| |||||||| |||||||||| ||| || ||||||||    
125194 atctaacttgagcaatttatttcattaaaaaaagttttaaaacaagaaatcatagtatttgac 125256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 10171699 - 10171653
Alignment:
201 acttcgacaccgctagtgtaaaaacaataggacaccgacactgctac 247  Q
    ||||||||||||||||||||||||  ||||||||||||||| |||||    
10171699 acttcgacaccgctagtgtaaaaaatataggacaccgacaccgctac 10171653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 388
Target Start/End: Complemental strand, 50127306 - 50127225
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctact 388  Q
    |||||||||||| ||| ||||||||||| | ||||||||| |||||||||   || |||||| ||||||||| ||||||||||    
50127306 catctaacttgaacaatttatttcattaaataaagttctataacaagatacaatagtatttggcctttattt-ttcatctact 50127225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 306 - 356
Target Start/End: Complemental strand, 19415713 - 19415663
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatat 356  Q
    ||||||| |||||||| |||| |||||  ||||||||||||||||||||||    
19415713 catctaaattgagcaatttatgtcattttaaaaagttctaaaacaagatat 19415663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 310 - 548
Target Start/End: Complemental strand, 70215 - 69976
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnn-----gctagaa 404  Q
    ||||| |||||| ||| || |||  ||||||||||||||||||||||| || |||||||| |||||||||||||||| | |            |||| ||    
70215 taactcgagcaatttactttattgaaaaaagttctaaaacaagatatcatagtatttgacatttatttattcatctaatataaagaaaaaaaagctaaaa 70116  T
405 atgttataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacatatgtaactcttgtatctacagtatgtggaagcaagagagaa 504  Q
    ||||   |||||| | |||| ||||| |||| ||||||||||||||||| |||| |||||||||| ||||||||||||  | ||| ||| || |||||||    
70115 atgt---aatcaactttaatttctataaccctctaattgatcaacatttctcaacacatatgtaattcttgtatctacgttgtgtagaaccatgagagaa 70019  T
505 aaagatgtttttgatatttgtctgagttgtccgtcacggctcat 548  Q
    ||| |||||| ||| |||| | ||||||||||| |||| |||||    
70018 aaa-atgtttatgacatttatttgagttgtccgacacgactcat 69976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0325
Description:

Target: scaffold0325; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 463
Target Start/End: Original strand, 12898 - 13051
Alignment:
310 taacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctactttnnnnnnngctagaaatgtt 409  Q
    |||||||||||| |||||||||   ||||||||| |||||||||| || || |||||||| |||||||||||||||||| |       |||| |||  ||    
12898 taacttgagcaatttatttcatcgaaaaaagttcgaaaacaagatgtcctagtatttgacatttatttattcatctactatcaaaaaagctaaaaacatt 12997  T
410 ataatcaattgtaatgtctattaccccctaattgatcaacatttttcaaaacat 463  Q
     ||||||| | |||| ||||| ||| |||||||||||||| ||| |||| ||||    
12998 gtaatcaactttaatttctataacctcctaattgatcaacgtttctcaacacat 13051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1723 (Bit Score: 44; Significance: 9e-16; HSPs: 1)
Name: scaffold1723
Description:

Target: scaffold1723; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 306 - 385
Target Start/End: Complemental strand, 483 - 404
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatct 385  Q
    |||||||||||||||| ||||||||||| ||||| ||||| |||||||||   || |||||||||||||||||| |||||    
483 catctaacttgagcaaattatttcattaaaaaaaattctataacaagatacaatagtatttgacctttatttatccatct 404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 317 - 387
Target Start/End: Original strand, 209216 - 209286
Alignment:
317 agcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttatttattcatctac 387  Q
    ||||| ||||||||||| ||||||||||| ||||| |||    |||||||| ||||||||||| |||||||    
209216 agcaatttatttcattaaaaaaagttctataacaaaatacaacaatatttggcctttatttatccatctac 209286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0891 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0891
Description:

Target: scaffold0891; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 306 - 375
Target Start/End: Complemental strand, 2431 - 2363
Alignment:
306 catctaacttgagcaagttatttcattagaaaaagttctaaaacaagatatcgtaatatttgacctttat 375  Q
    |||||| ||||||||| ||||||| ||| |||||||| ||||| ||||||   |||||||||||||||||    
2431 catctaccttgagcaatttatttcttta-aaaaagttataaaataagatacgataatatttgacctttat 2363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136964 times since January 2019
Visitors: 1443