View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-7 (Length: 650)

Name: NF0110-INSERTION-7
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0110-INSERTION-7
NF0110-INSERTION-7
[»] chr8 (5 HSPs)
chr8 (125-510)||(13509072-13509460)
chr8 (125-510)||(13598602-13598990)
chr8 (573-650)||(13505974-13506051)
chr8 (8-129)||(13510757-13510871)
chr8 (8-129)||(13600288-13600402)


Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 125 - 510
Target Start/End: Complemental strand, 13509460 - 13509072
Alignment:
125 ttgcacaagcagtattgttatatagagatgttgaactctaccaccatgtttannnnnnnnnnnnnnnnnnnatcctttgtt-taaattgtggacgatttg 223  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||                   ||| |||||| ||||||||||||||||||    
13509460 ttgcacaagcagtattgttatatagaaatgttgaactctaccaccatgtttattttttcttttctttctttatcatttgttataaattgtggacgatttg 13509361  T
224 tttgnnnnnnnn--cttccaaaccaaccctgcaaaattgtcactatagagtactttattctcgcattcaatcaatttaacttttactttactacccccac 321  Q
    ||||          |||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||| |||||||     
13509360 tttgaaaaaaaaaacttcaaaaccaaccctgcaaaattgtcactatagagtacttcattctcacattcaatcaatttaacttttaatttacaacccccat 13509261  T
322 ggcagtttctgcaacaacattgcataaaaaattattattaccccgcctgggttgaggcaaaatggacggttttttgggttgattcgtttggatctatcta 421  Q
    | |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
13509260 gacagtttctgctacaacattgcataaaaaattattattaccccgcctgggttgtggcaaaatggacggttttttgggttgattcgtttggatctatcta 13509161  T
422 cgaaagagtttccgagtaagcttaatcaaataatcaattccacattttgatgttgtttgttgctatgtattttagtatacaaccatgaa 510  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
13509160 cgaaagagtttccgagtaagcttaatcaaataatcaattccacattttgatgttgtctgttgctatgtattttagtatacaaccatgaa 13509072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 125 - 510
Target Start/End: Complemental strand, 13598990 - 13598602
Alignment:
125 ttgcacaagcagtattgttatatagagatgttgaactctaccaccatgtttannnnnnnnnnnnnnnnnnnatcctttgtt-taaattgtggacgatttg 223  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||                   ||| |||||| ||||||||||||||||||    
13598990 ttgcacaagcagtattgttatatagaaatgttgaactctaccaccatgtttattttttcttttctttctttatcatttgttataaattgtggacgatttg 13598891  T
224 tttgnnnnnnnn--cttccaaaccaaccctgcaaaattgtcactatagagtactttattctcgcattcaatcaatttaacttttactttactacccccac 321  Q
    ||||          |||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||| |||||||     
13598890 tttgaaaaaaaaaacttcaaaaccaaccctgcaaaattgtcactatagagtacttcattctcacattcaatcaatttaacttttaatttacaacccccat 13598791  T
322 ggcagtttctgcaacaacattgcataaaaaattattattaccccgcctgggttgaggcaaaatggacggttttttgggttgattcgtttggatctatcta 421  Q
    | |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
13598790 gacagtttctgctacaacattgcataaaaaattattattaccccgcctgggttgtggcaaaatggacggttttttgggttgattcgtttggatctatcta 13598691  T
422 cgaaagagtttccgagtaagcttaatcaaataatcaattccacattttgatgttgtttgttgctatgtattttagtatacaaccatgaa 510  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
13598690 cgaaagagtttccgagtaagcttaatcaaataatcaattccacattttgatgttgtctgttgctatgtattttagtatacaaccatgaa 13598602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 573 - 650
Target Start/End: Complemental strand, 13506051 - 13505974
Alignment:
573 ctattgacatttgttcacaagagcgattatatgaaacggggagaaagtaccttgcatattgaaaagaaagcatcgtcc 650  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13506051 ctattgacatttgttcacaagagcgattatatgaaacggggagaaagtaccttgcatattgaaaagaaagcatcgtcc 13505974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 13510871 - 13510757
Alignment:
8 gtatatatgtcttgctctttcttcaattttttcacacttattgcggtaatcacnnnnnnncctgctcatttcttcatccttttcttcttcttaattgtgt 107  Q
    |||||||||||||||||||    ||||||||||||||||||||||||||||||        |  || |||||||||||||||||||||||||||||||||    
13510871 gtatatatgtcttgctctt----caattttttcacacttattgcggtaatcacttttttttc--ct-atttcttcatccttttcttcttcttaattgtgt 13510779  T
108 gttatgcagtggaggagttgca 129  Q
    ||||||||||||||||||||||    
13510778 gttatgcagtggaggagttgca 13510757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 13600402 - 13600288
Alignment:
8 gtatatatgtcttgctctttcttcaattttttcacacttattgcggtaatcacnnnnnnncctgctcatttcttcatccttttcttcttcttaattgtgt 107  Q
    |||||||||||||||||||    ||||||||||||||||||||||||||||||        |  || |||||||||||||||||||||||||||||||||    
13600402 gtatatatgtcttgctctt----caattttttcacacttattgcggtaatcacttttttttc--ct-atttcttcatccttttcttcttcttaattgtgt 13600310  T
108 gttatgcagtggaggagttgca 129  Q
    ||||||||||||||||||||||    
13600309 gttatgcagtggaggagttgca 13600288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137489 times since January 2019
Visitors: 1448