View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-8 (Length: 788)

Name: NF0110-INSERTION-8
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0110-INSERTION-8
NF0110-INSERTION-8
[»] chr1 (12 HSPs)
chr1 (8-788)||(20026726-20027546)
chr1 (86-153)||(8573775-8573842)
chr1 (99-153)||(33934425-33934479)
chr1 (90-153)||(29689195-29689258)
chr1 (99-145)||(1570497-1570543)
chr1 (94-153)||(925260-925320)
chr1 (91-131)||(50944366-50944406)
chr1 (94-153)||(12779929-12779987)
chr1 (269-352)||(44258616-44258697)
chr1 (92-153)||(15874774-15874835)
chr1 (92-153)||(23329080-23329140)
chr1 (92-153)||(48419834-48419894)
[»] chr5 (14 HSPs)
chr5 (92-153)||(830884-830945)
chr5 (91-154)||(7938441-7938504)
chr5 (86-131)||(42515945-42515990)
chr5 (94-153)||(13998983-13999042)
chr5 (91-148)||(42919205-42919262)
chr5 (91-151)||(11992475-11992534)
chr5 (265-352)||(14620605-14620688)
chr5 (86-153)||(18524629-18524696)
chr5 (265-300)||(41645221-41645256)
chr5 (86-124)||(42506008-42506046)
chr5 (92-153)||(17916306-17916367)
chr5 (92-153)||(25524399-25524460)
chr5 (86-131)||(28868533-28868578)
chr5 (267-352)||(42104174-42104256)
[»] chr7 (17 HSPs)
chr7 (91-153)||(34728951-34729013)
chr7 (91-153)||(31283728-31283790)
chr7 (92-151)||(36610151-36610210)
chr7 (91-141)||(1748819-1748869)
chr7 (92-153)||(14243957-14244018)
chr7 (86-152)||(1766608-1766673)
chr7 (91-136)||(25489635-25489680)
chr7 (268-352)||(25440833-25440914)
chr7 (91-131)||(29366740-29366780)
chr7 (110-153)||(48006851-48006894)
chr7 (89-143)||(7628430-7628484)
chr7 (99-153)||(24007781-24007835)
chr7 (92-154)||(47741224-47741285)
chr7 (89-153)||(4676350-4676415)
chr7 (267-352)||(27947610-27947692)
chr7 (89-130)||(39618494-39618535)
chr7 (267-352)||(45948739-45948821)
[»] chr8 (6 HSPs)
chr8 (99-153)||(32161584-32161638)
chr8 (102-153)||(14976111-14976162)
chr8 (87-154)||(5918399-5918465)
chr8 (90-153)||(27023024-27023087)
chr8 (92-153)||(19369069-19369131)
chr8 (91-149)||(29039395-29039453)
[»] chr4 (12 HSPs)
chr4 (95-153)||(35518862-35518920)
chr4 (92-153)||(25065864-25065925)
chr4 (94-153)||(29656374-29656433)
chr4 (104-153)||(1361016-1361065)
chr4 (91-136)||(51400421-51400466)
chr4 (90-153)||(46251025-46251088)
chr4 (94-153)||(26510494-26510553)
chr4 (89-154)||(7059124-7059189)
chr4 (86-131)||(19442963-19443008)
chr4 (90-131)||(34658686-34658727)
chr4 (91-153)||(39227367-39227428)
chr4 (92-153)||(54856124-54856186)
[»] chr2 (13 HSPs)
chr2 (91-149)||(7603935-7603993)
chr2 (106-154)||(24100438-24100486)
chr2 (106-153)||(12069195-12069242)
chr2 (89-153)||(45406720-45406784)
chr2 (89-153)||(22882198-22882262)
chr2 (89-153)||(36205389-36205453)
chr2 (91-154)||(42185027-42185090)
chr2 (89-153)||(42651638-42651701)
chr2 (305-352)||(7874755-7874802)
chr2 (94-153)||(20950101-20950160)
chr2 (89-131)||(18072173-18072215)
chr2 (89-153)||(27360644-27360708)
chr2 (89-154)||(35126192-35126257)
[»] scaffold0543 (1 HSPs)
scaffold0543 (92-151)||(5028-5087)
[»] scaffold0492 (1 HSPs)
scaffold0492 (92-151)||(6574-6633)
[»] scaffold0836 (1 HSPs)
scaffold0836 (100-154)||(1452-1505)
[»] chr6 (4 HSPs)
chr6 (91-153)||(14964994-14965056)
chr6 (91-153)||(17352869-17352931)
chr6 (91-153)||(3103523-3103585)
chr6 (116-153)||(3257687-3257723)
[»] chr3 (9 HSPs)
chr3 (90-152)||(15522267-15522329)
chr3 (89-153)||(24487579-24487643)
chr3 (89-153)||(45885659-45885723)
chr3 (86-153)||(18956716-18956783)
chr3 (90-153)||(42392169-42392232)
chr3 (91-153)||(611425-611487)
chr3 (105-155)||(4617417-4617467)
chr3 (91-153)||(21789990-21790052)
chr3 (267-348)||(50088428-50088505)
[»] scaffold0123 (1 HSPs)
scaffold0123 (92-152)||(31106-31166)
[»] scaffold0196 (1 HSPs)
scaffold0196 (100-153)||(8450-8503)
[»] scaffold0041 (1 HSPs)
scaffold0041 (92-153)||(32336-32397)


Alignment Details
Target: chr1 (Bit Score: 571; Significance: 0; HSPs: 12)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 571; E-Value: 0
Query Start/End: Original strand, 8 - 788
Target Start/End: Complemental strand, 20027546 - 20026726
Alignment:
8 cactcaagtaattagggttggcaaagtagggtttgtctattgtacttttggattatataataagataagataagataagatgacatttttggaaagagaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20027546 cactcaagtaattagggttggcaaagtagggtttgtctattgtacttttggattatataataagataagataagataagatgacatttttggaaagagaa 20027447  T
108 aaagtcagtccaaaagagctgaaatgagtaattttctttatatat----------------atgaagtaggtggtagacgacggatgtttccgtaggggg 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||                |||||||||||||||||||||| |||||||||||||||     
20027446 aaagtcagtccaaaagagctgaaatgagtaattttctttatatattatataatttatatatatgaagtaggtggtagacgacgaatgtttccgtagggga 20027347  T
192 gtctacctagctgggatgttgtggattcatcttcacgatgttcgtacctctttgtttaaaaaagaatttaccacatccgtttcaaaataagtgttgtttt 291  Q
     ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||| |||| ||| |||||||||||||    
20027346 -tctacctagctggaatgttgtggattcatcttcacgatgttcgtacctctttgtttaaaaaaagatttaccacatctgttttaaagtaagtgttgtttt 20027248  T
292 agcaaaaaa--ttgtaaaattattttaaaattaacgtcacctcagtttccaatgcaataataannnnnnnnnnnnn-caattataccattcaattaaaaa 388  Q
    |||||||||  |||||||||||||||||||| ||| |||||||||||||||||||||||||||              |||||||| ||||||||||||||    
20027247 agcaaaaaaaattgtaaaattattttaaaataaacatcacctcagtttccaatgcaataataatattttttttttttcaattatatcattcaattaaaaa 20027148  T
389 tattgataattgagattttagaccaaattcttgttcccgcttctatccacttccactttcatttgaatttcgtagttaacccaacggtacgcttcca-ac 487  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
20027147 tattgataattgagatttgagaccaaattcttgttcccgcttctatccacttccactttcatttgaatttcgtagttaacccaacggtacgcttccacac 20027048  T
488 agaccagatccaacgcaacagaagagaaaacctctctctcttccatggctccaaccttcgtcttccctcgcactctccaacacctcgaacaagattcatc 587  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20027047 agaccagatccaacgcaacagaagagaaaacctctctctcttccatggctccaaccttcgtcttccctcgcactctccaacacctcgaacaagattcatc 20026948  T
588 ctccgaaga---------------------caacaacaacaatctcttcgtccaaaaccctacaaacatctcctccctctcttcctcccaactcgaagaa 666  Q
    |||||||||                     |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
20026947 ctccgaagacaacgacaacaacaacaacaacaacaacaacaatctctcagtccaaaaccctacaaacatctcctccctctcttcctcccaactcgaagaa 20026848  T
667 ttcgtcaaaggcgtctcattcgatctctccgacagagaaatcctctgcatccaagaccaagacgtattcgaccgtgtttactctttggttcgcggttact 766  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20026847 ttcgtcaaaggcgtctcattcgatctctccgacagagaaatcctctgcatccaagaccaagacgtattcgaccgtgtttactctttggttcgcggttact 20026748  T
767 cttctttacatcattcatgtaa 788  Q
    ||||||||||||||||||||||    
20026747 cttctttacatcattcatgtaa 20026726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 153
Target Start/End: Complemental strand, 8573842 - 8573775
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||   || ||||||||||||||||    
8573842 gatgacatttttgtaaagggaaaaagtcagtccaaaagagctgaaaaatgttattttctttatatata 8573775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 153
Target Start/End: Original strand, 33934425 - 33934479
Alignment:
99 gaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||| |||||||||||| |||||||||||||||||||| ||||||||||||||||    
33934425 gaaaaagaaaaagtcagcccaaaagagctgaaatgagttattttctttatatata 33934479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 90 - 153
Target Start/End: Complemental strand, 29689258 - 29689195
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||| |||||||||| ||||  ||||||||| | |||||||| ||||||||||||||||    
29689258 acatttttgaaaagagaaaaggtcaacccaaaagaggttaaatgagttattttctttatatata 29689195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 145
Target Start/End: Original strand, 1570497 - 1570543
Alignment:
99 gaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctt 145  Q
    ||||||||||||||||||||||||||||| ||||||||  |||||||    
1570497 gaaagagaaaaagtcagtccaaaagagcttaaatgagttgttttctt 1570543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 94 - 153
Target Start/End: Original strand, 925260 - 925320
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaa-tgagtaattttctttatatata 153  Q
    |||| ||||||||||||||||| |||||||||||||||  ||||  |||||||||||||||    
925260 ttttagaaagagaaaaagtcagcccaaaagagctgaaagagagttgttttctttatatata 925320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 50944366 - 50944406
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    ||||||||||||||||||||||||| ||||||||| |||||    
50944366 catttttggaaagagaaaaagtcagaccaaaagagatgaaa 50944406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 12779987 - 12779929
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||| |||||||||| |||||||||||||||  |||  |||||||||||||||    
12779987 ttttggaaaga-aaaaagtcagcccaaaagagctgaaagaagttgttttctttatatata 12779929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 269 - 352
Target Start/End: Complemental strand, 44258697 - 44258616
Alignment:
269 cgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcacct-cagtttccaatgcaataataa 352  Q
    ||||||||||| ||||| | ||||||||||||    |||||| ||||||||| || ||||| | |||||||||||||||||||||    
44258697 cgtttcaaaatgagtgtcgctttagcaaaaaaa---aaaattgttttaaaatgaatgtcactttcagtttccaatgcaataataa 44258616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 15874835 - 15874774
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||||||| ||| | |||||| ||||||   || ||||||||||||||||    
15874835 atttttggaaagagaaaaaggcagcctaaaagaactgaaagaggttattttctttatatata 15874774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 23329140 - 23329080
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||| ||||| ||||| |||| |||||| || |||||||||| ||||||||||||||||    
23329140 atttttgaaaagaaaaaaa-tcagcccaaaaaagttgaaatgagttattttctttatatata 23329080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Original strand, 48419834 - 48419894
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||| ||||| |||||||||| ||||||| ||||||||  ||| |||||||||||||||    
48419834 atttttgaaaaga-aaaaagtcagcccaaaagtgctgaaataggtagttttctttatatata 48419894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 50; Significance: 3e-19; HSPs: 14)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 830945 - 830884
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||    
830945 attttgggaaagtgaaaaagtcagtccaaaagagctgaaatgagttattttctttatatata 830884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 91 - 154
Target Start/End: Original strand, 7938441 - 7938504
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    |||||||||||| |||||| ||||||||||||||||||||| |||| ||||||||||| |||||    
7938441 catttttggaaaaagaaaaggtcagtccaaaagagctgaaaggagttattttctttatttatat 7938504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 131
Target Start/End: Complemental strand, 42515990 - 42515945
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    |||| |||||||||||||||||||||||||||||||||||||||||    
42515990 gatggcatttttggaaagagaaaaagtcagtccaaaagagctgaaa 42515945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 13999042 - 13998983
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||||||||||||||||||| |||||   || ||||||| ||||||||    
13999042 ttttggaaagagaaaaagtcagtccaaaagagttgaaagaggttattttctctatatata 13998983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 148
Target Start/End: Original strand, 42919205 - 42919262
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttat 148  Q
    ||||||||| ||||||||| ||||| ||||||||||| ||| |||| |||||||||||    
42919205 catttttgggaagagaaaaggtcagaccaaaagagcttaaaggagttattttctttat 42919262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 151
Target Start/End: Original strand, 11992475 - 11992534
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatata 151  Q
    |||||||||||| ||||||||||||||||| |||||| ||| | || ||||||||||||||    
11992475 catttttggaaa-agaaaaagtcagtccaacagagcttaaaggggttattttctttatata 11992534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 265 - 352
Target Start/End: Complemental strand, 14620688 - 14620605
Alignment:
265 catccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcac-ctcagtttccaatgcaataataa 352  Q
    ||||||||||||||| ||||| |||||||| ||||     |||||||||| ||||| || |||||  ||||||||||||||||||||||    
14620688 catccgtttcaaaatgagtgtcgttttagccaaaa-----aaaattatttcaaaatgaatgtcactttcagtttccaatgcaataataa 14620605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 153
Target Start/End: Complemental strand, 18524696 - 18524629
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| ||||||| ||||||||||||||||  ||||| ||||||||   || ||||||||||||||||    
18524696 gatgatatttttgaaaagagaaaaagtcagcacaaaatagctgaaagaggttattttctttatatata 18524629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 265 - 300
Target Start/End: Original strand, 41645221 - 41645256
Alignment:
265 catccgtttcaaaataagtgttgttttagcaaaaaa 300  Q
    ||||||||||||||| ||||||||||||||||||||    
41645221 catccgtttcaaaatgagtgttgttttagcaaaaaa 41645256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 86 - 124
Target Start/End: Complemental strand, 42506046 - 42506008
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaaga 124  Q
    |||| ||||||||||||||||||||||||| ||||||||    
42506046 gatggcatttttggaaagagaaaaagtcagcccaaaaga 42506008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Original strand, 17916306 - 17916367
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| ||||||| ||||||||||  ||||| ||||||||  ||| ||||||||||||||||    
17916306 attttcggaaagaaaaaaagtcagcacaaaaaagctgaaaatagttattttctttatatata 17916367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 25524460 - 25524399
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||| |||| ||||||||||  ||||||||||||||||||||  |||| | ||||||||    
25524460 atttttgaaaagtgaaaaagtcaacccaaaagagctgaaatgagttgttttttatatatata 25524399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 131
Target Start/End: Original strand, 28868533 - 28868578
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    ||||||||||||  ||||||||||||||| |||||||||| |||||    
28868533 gatgacatttttaaaaagagaaaaagtcaatccaaaagagttgaaa 28868578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 42104256 - 42104174
Alignment:
267 tccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcacct-cagtttccaatgcaataataa 352  Q
    ||||||||||||| ||||| |||||||| |||||    |||||| ||| ||||| || ||||| | |||||||||||||||||||||    
42104256 tccgtttcaaaatgagtgtcgttttagccaaaaa----aaaattgtttcaaaatgaatgtcactttcagtttccaatgcaataataa 42104174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 47; Significance: 2e-17; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 91 - 153
Target Start/End: Complemental strand, 34729013 - 34728951
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||| ||||||||||||||||| |||||||| |||||||||| ||||||||||||||||    
34729013 catttttgcaaagagaaaaagtcagttcaaaagagttgaaatgagttattttctttatatata 34728951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 91 - 153
Target Start/End: Original strand, 31283728 - 31283790
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||||||||||||||||  ||||||||||| |||||||| | ||||||||||||||    
31283728 catttttggaaagagaaaaagtcaacccaaaagagcttaaatgagttactttctttatatata 31283790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 151
Target Start/End: Original strand, 36610151 - 36610210
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatata 151  Q
    ||||||| ||||||||||||||||||||||||||||||||   || ||||||||||||||    
36610151 atttttgaaaagagaaaaagtcagtccaaaagagctgaaagatgttattttctttatata 36610210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 141
Target Start/End: Original strand, 1748819 - 1748869
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattt 141  Q
    |||||||||||||||||||||||| ||||||||| ||||||||||| ||||    
1748819 catttttggaaagagaaaaagtcaatccaaaagaactgaaatgagttattt 1748869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 14244018 - 14243957
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||||||||| ||||| |||||||||| | |||| ||| ||||||||||||||||    
14244018 atttttggaaagagaaatagtcactccaaaagagtttaaataagttattttctttatatata 14243957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 152
Target Start/End: Complemental strand, 1766673 - 1766608
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatat 152  Q
    |||||||||||||||||||||||| ||||||||||| || || ||| | || |||||||||||||||    
1766673 gatgacatttttggaaagagaaaacgtcagtccaaatgaacttaaa-gggttattttctttatatat 1766608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 136
Target Start/End: Complemental strand, 25489680 - 25489635
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagt 136  Q
    |||||||| ||||||||||||||||  |||||||||||||||||||    
25489680 catttttgaaaagagaaaaagtcagctcaaaagagctgaaatgagt 25489635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 268 - 352
Target Start/End: Original strand, 25440833 - 25440914
Alignment:
268 ccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcacct-cagtttccaatgcaataataa 352  Q
    |||||||||||| ||||| | ||||||||||||    ||||||||||||||||  | ||||| | |||||||||||||||||||||    
25440833 ccgtttcaaaatgagtgtcgctttagcaaaaaa----aaaattattttaaaatatatgtcactttcagtttccaatgcaataataa 25440914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 29366740 - 29366780
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    ||||||||||||||||||||||||| |||||| ||||||||    
29366740 catttttggaaagagaaaaagtcagcccaaaatagctgaaa 29366780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 153
Target Start/End: Complemental strand, 48006894 - 48006851
Alignment:
110 agtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||| |||||||||| ||||| ||||||||||    
48006894 agtcagtccaaaagagttgaaatgagttattttatttatatata 48006851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 89 - 143
Target Start/End: Complemental strand, 7628484 - 7628430
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttc 143  Q
    |||||||||  ||||||||||||||| ||||||||| ||||||||| | ||||||    
7628484 gacatttttaaaaagagaaaaagtcaatccaaaagaactgaaatgaattattttc 7628430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 24007835 - 24007781
Alignment:
99 gaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||| |||  ||||||||  |||||||||| ||||||||||||||||    
24007835 gaaagagaaaaaatcaacccaaaagaattgaaatgagttattttctttatatata 24007781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 154
Target Start/End: Complemental strand, 47741285 - 47741224
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    ||||||| |||| ||||| ||||| ||||||  || |||||||||||||||||||||||||||    
47741285 atttttgaaaag-gaaaatgtcagcccaaaaatgccgaaatgagtaattttctttatatatat 47741224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 4676350 - 4676415
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaa-gagctgaaatgagtaattttctttatatata 153  Q
    |||| ||||||||||| ||||| |||| |||||| ||||||||| | || ||||||||||||||||    
4676350 gacagttttggaaagaaaaaaattcagcccaaaaagagctgaaaagggttattttctttatatata 4676415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 27947692 - 27947610
Alignment:
267 tccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcac-ctcagtttccaatgcaataataa 352  Q
    ||||||||||||| ||||| ||||||||||||||    |||||| | ||||||| || |||||  ||||||| ||||||||||||||    
27947692 tccgtttcaaaatgagtgtcgttttagcaaaaaa----aaaattgtcttaaaatgaatgtcactttcagttttcaatgcaataataa 27947610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 130
Target Start/End: Complemental strand, 39618535 - 39618494
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaa 130  Q
    ||||||||||||| ||||||||||||| |||||| |||||||    
39618535 gacatttttggaatgagaaaaagtcagcccaaaatagctgaa 39618494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 267 - 352
Target Start/End: Complemental strand, 45948821 - 45948739
Alignment:
267 tccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcacct-cagtttccaatgcaataataa 352  Q
    ||||||| ||||| ||||| ||||||||||||||    |||||| ||| ||||| || ||||| | |||||||||||||||||||||    
45948821 tccgttttaaaatgagtgtcgttttagcaaaaaa----aaaattgtttcaaaatgaatgtcactttcagtttccaatgcaataataa 45948739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 99 - 153
Target Start/End: Complemental strand, 32161638 - 32161584
Alignment:
99 gaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||||||||||| ||||||||||| | ||||||||||||||||    
32161638 gaaagagaaaaagtcagtccaaaaaagctgaaatgatttattttctttatatata 32161584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 102 - 153
Target Start/End: Original strand, 14976111 - 14976162
Alignment:
102 agagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||| |||||||||||||||  |||| |||||||||||||||    
14976111 agagaaaaagtcagcccaaaagagctgaaagaagtagttttctttatatata 14976162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 154
Target Start/End: Complemental strand, 5918465 - 5918399
Alignment:
87 atgacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    |||||||||||| ||||| ||||| |||| ||||||||||||||| | | | ||||||||||||||||    
5918465 atgacatttttg-aaagaaaaaaaatcagcccaaaagagctgaaaggggaatttttctttatatatat 5918399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 153
Target Start/End: Original strand, 27023024 - 27023087
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||| ||||||||||||| |||| | |||||| ||||| |||  ||||||||||||||||    
27023024 acattttttgaaagagaaaaagacagtgctaaagagttgaaaggaggtattttctttatatata 27023087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 153
Target Start/End: Original strand, 19369069 - 19369131
Alignment:
92 atttttggaaagagaa-aaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||| |||||||  ||||||||||||||   ||| ||||||||||||||||    
19369069 atttttggaaagagaagaaagtcaacccaaaagagctgaatgaagttattttctttatatata 19369131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 149
Target Start/End: Complemental strand, 29039453 - 29039395
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttata 149  Q
    ||||||||||||||||||||||||| | |||||| ||||||   || ||||||||||||    
29039453 catttttggaaagagaaaaagtcagcctaaaagaactgaaagaggttattttctttata 29039395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 95 - 153
Target Start/End: Complemental strand, 35518920 - 35518862
Alignment:
95 tttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||| ||||||||||||||| ||||||||||||||||||| | ||||||||||||||||    
35518920 tttgaaaagagaaaaagtcaatccaaaagagctgaaatgaattattttctttatatata 35518862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 153
Target Start/End: Original strand, 25065864 - 25065925
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| ||||||||||||||||||||||||||||||||||  | | ||||||||||||||||    
25065864 attttcggaaagagaaaaagtcagtccaaaagagctgaaagaaattattttctttatatata 25065925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 29656433 - 29656374
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||||||||| |||||||||||||||   || ||||||||||||||||    
29656433 ttttggaaagagaaaaagtcagcccaaaagagctgaaagaggttattttctttatatata 29656374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 1361065 - 1361016
Alignment:
104 agaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||| ||||||||| |||||||| ||||||||||||||||    
1361065 agaaaaagtcagtctaaaagagctaaaatgagttattttctttatatata 1361016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 136
Target Start/End: Original strand, 51400421 - 51400466
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagt 136  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||    
51400421 catttttggaaagagaaaaagtcaacccaaaagagctgaaatgagt 51400466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 153
Target Start/End: Complemental strand, 46251088 - 46251025
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaatgag-taattttctttatatata 153  Q
    ||||||||||||||||||||||||| | |||||||||||||| ||| | ||||||||||||||||    
46251088 acatttttggaaagagaaaaagtcaattcaaaagagctgaaa-gagattattttctttatatata 46251025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 94 - 153
Target Start/End: Original strand, 26510494 - 26510553
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| ||||||||||||||| | |||||||||||||| |||| ||||| ||||||||||    
26510494 ttttgaaaagagaaaaagtcaattcaaaagagctgaaaagagttattttatttatatata 26510553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 7059189 - 7059124
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgag-taattttctttatatatat 154  Q
    ||||||||||||||||| |||||||||  |||||||||||||| ||| | |||||||||||||||||    
7059189 gacatttttggaaagaggaaaagtcagctcaaaagagctgaaa-gagattattttctttatatatat 7059124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 131
Target Start/End: Original strand, 19442963 - 19443008
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    |||||||||||||||||||||||||||||| |||| |||| |||||    
19442963 gatgacatttttggaaagagaaaaagtcagcccaagagagttgaaa 19443008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 131
Target Start/End: Complemental strand, 34658727 - 34658686
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    ||||||||| ||||||||||||||||| ||||||||||||||    
34658727 acatttttgaaaagagaaaaagtcagttcaaaagagctgaaa 34658686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 153
Target Start/End: Original strand, 39227367 - 39227428
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||| ||||||||||||||||   ||||||||||||||| ||  |||||||||||||||    
39227367 catttttgaaaagagaaaaagtcagcttaaaagagctgaaatg-gttgttttctttatatata 39227428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 54856186 - 54856124
Alignment:
92 atttttggaaagagaaaaagtcag-tccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||| |||| |||  ||||||||||||||||| |||  |||||||||||||||    
54856186 atttttggaaagaggaaaaatcaaatccaaaagagctgaaattagtttttttctttatatata 54856124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 91 - 149
Target Start/End: Original strand, 7603935 - 7603993
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttata 149  Q
    ||||||||||||||||||||||||| ||||||||||| |||||| | ||||||||||||    
7603935 catttttggaaagagaaaaagtcagcccaaaagagctaaaatgatttattttctttata 7603993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 24100486 - 24100438
Alignment:
106 aaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    |||||||||| ||||||||| |||||||||| |||||||||||||||||    
24100486 aaaaagtcagcccaaaagagatgaaatgagttattttctttatatatat 24100438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 12069242 - 12069195
Alignment:
106 aaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||  ||||||||||||||||||| ||||||||||||||||    
12069242 aaaaagtcaggtcaaaagagctgaaatgagttattttctttatatata 12069195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 153
Target Start/End: Complemental strand, 45406784 - 45406720
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgag-taattttctttatatata 153  Q
    |||||||||||||||||||||| ||| ||| |||||||||||| ||| | ||||||||||||||||    
45406784 gacatttttggaaagagaaaaaatcaatcctaaagagctgaaa-gagattattttctttatatata 45406720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 22882198 - 22882262
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||| ||||||||||| || ||||||||||||||||||   ||  |||||||||||||||    
22882198 gacattttttgaaagagaaaatgtaagtccaaaagagctgaaagaggttgttttctttatatata 22882262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 36205389 - 36205453
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||| |||||| ||||| ||||| |||||||| | |||| ||| ||||||||||||||||    
36205389 gacattttttgaaagaaaaaaattcagttcaaaagagttaaaataagttattttctttatatata 36205453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 154
Target Start/End: Complemental strand, 42185090 - 42185027
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgag-taattttctttatatatat 154  Q
    |||||||||||||||||||||||||||||||| ||  |||| ||| | |||||||||||||||||    
42185090 catttttggaaagagaaaaagtcagtccaaaaaaggggaaa-gagattattttctttatatatat 42185027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Complemental strand, 42651701 - 42651638
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||| |||||||||||||||| | |||||||||||||| | ||  |||||||||||||||    
42651701 gacattttttgaaagagaaaaagtcatttcaaaagagctgaaaag-gttgttttctttatatata 42651638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 305 - 352
Target Start/End: Complemental strand, 7874802 - 7874755
Alignment:
305 aaaattattttaaaattaacgtcacctcagtttccaatgcaataataa 352  Q
    ||||||||||||||||||| ||||| |  |||||||||||||||||||    
7874802 aaaattattttaaaattaatgtcacttttgtttccaatgcaataataa 7874755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 153
Target Start/End: Original strand, 20950101 - 20950160
Alignment:
94 ttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||| |||||| |||||| ||| |||||||| |||||||||  ||||||||||||||||    
20950101 ttttgaaaagagtaaaagttagttcaaaagagttgaaatgagctattttctttatatata 20950160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 89 - 131
Target Start/End: Complemental strand, 18072215 - 18072173
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaa 131  Q
    |||||||||| ||||||||||||||||||||||  ||||||||    
18072215 gacatttttgaaaagagaaaaagtcagtccaaagaagctgaaa 18072173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 27360644 - 27360708
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgag-taattttctttatatata 153  Q
    ||||| |||| ||| ||||||| |||||||||||||||||||| ||| | ||||||||||||||||    
27360644 gacatatttgaaaatagaaaaaatcagtccaaaagagctgaaa-gagattattttctttatatata 27360708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 154
Target Start/End: Original strand, 35126192 - 35126257
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    |||||||||  |||||||||||||||  |||||||| ||||||  ||| ||||||| |||||||||    
35126192 gacatttttttaaagagaaaaagtcaacccaaaagaactgaaaaaagttattttctatatatatat 35126257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0543 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0543
Description:

Target: scaffold0543; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 5087 - 5028
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatata 151  Q
    ||||||| |||||||||||||||  ||||||||| |||||||||| ||||||||||||||    
5087 atttttgaaaagagaaaaagtcatcccaaaagagttgaaatgagttattttctttatata 5028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0492 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0492
Description:

Target: scaffold0492; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 6633 - 6574
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatata 151  Q
    ||||||| |||||||||||||||  ||||||||| |||||||||| ||||||||||||||    
6633 atttttgaaaagagaaaaagtcatcccaaaagagttgaaatgagttattttctttatata 6574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0836 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0836
Description:

Target: scaffold0836; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 154
Target Start/End: Complemental strand, 1505 - 1452
Alignment:
100 aaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatat 154  Q
    ||||||||||| |||||||||||||| |||||||||| |||||||||||||||||    
1505 aaagagaaaaa-tcagtccaaaagagttgaaatgagttattttctttatatatat 1452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.000000000001; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 153
Target Start/End: Complemental strand, 14965056 - 14964994
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||| ||||||||||||| || |||||||||||||||| | || ||||||||||||||||    
14965056 catttttagaaagagaaaaagacattccaaaagagctgaaaagggttattttctttatatata 14964994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 153
Target Start/End: Complemental strand, 17352931 - 17352869
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||||||||||||||||| ||||||||| ||||| | ||  |||||||||||||||    
17352931 catttttggaaagagaaaaagtcagcccaaaagaggtgaaaggggttgttttctttatatata 17352869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 153
Target Start/End: Original strand, 3103523 - 3103585
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||| |||| ||||||||||| | ||||||||| ||||||||  |||||||||||||||    
3103523 catttttgaaaagggaaaaagtcagcctaaaagagcttaaatgagtttttttctttatatata 3103585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 153
Target Start/End: Original strand, 3257687 - 3257723
Alignment:
116 tccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||||||||| |||||||||||||||||||    
3257687 tccaaaagagctgaaatg-gtaattttctttatatata 3257723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.0000000003; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 152
Target Start/End: Complemental strand, 15522329 - 15522267
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatat 152  Q
    ||||||||||||||||||||||  | ||||||||||||||||   || |||||||||||||||    
15522329 acatttttggaaagagaaaaagatattccaaaagagctgaaacaggttattttctttatatat 15522267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Complemental strand, 24487643 - 24487579
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||  |||||||||||||| | | ||||||||| ||||||||  |||||||||||||||    
24487643 gacattttttaaaagagaaaaagtcggcctaaaagagcttaaatgagttgttttctttatatata 24487579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Complemental strand, 45885723 - 45885659
Alignment:
89 gacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||| ||||||||||||||||  ||||||||| |||||   || ||||||||||||||||    
45885723 gacattttttgaaagagaaaaagtcaacccaaaagagttgaaagatgttattttctttatatata 45885659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 153
Target Start/End: Complemental strand, 18956783 - 18956716
Alignment:
86 gatgacatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||| |||||||||||| |||||| ||||  |||||||||||||||   || ||||||||||||||||    
18956783 gatggcatttttggaaatagaaaaggtcaacccaaaagagctgaaagaggttattttctttatatata 18956716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 153
Target Start/End: Original strand, 42392169 - 42392232
Alignment:
90 acatttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||  |||||||||||||||  |||||| || ||||| |||| ||||||||||||||||    
42392169 acattttttaaaagagaaaaagtcaacccaaaaaagttgaaaggagttattttctttatatata 42392232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 153
Target Start/End: Complemental strand, 611487 - 611425
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||| |||||||||||||| | |||||||||||||||   ||  |||||||||||||||    
611487 catttttgaaaagagaaaaagtcggcccaaaagagctgaaagatgttgttttctttatatata 611425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 4617417 - 4617467
Alignment:
105 gaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatatatg 155  Q
    |||||| |||||||||||  ||||||| | |||||||||||||||||||||    
4617417 gaaaaattcagtccaaaaatgctgaaaggggtaattttctttatatatatg 4617467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 153
Target Start/End: Original strand, 21789990 - 21790052
Alignment:
91 catttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    |||||||||||| |||||||| |||  ||||||||||||||||| |  ||||| |||||||||    
21789990 catttttggaaatagaaaaagccagctcaaaagagctgaaatgaattgttttccttatatata 21790052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 267 - 348
Target Start/End: Complemental strand, 50088505 - 50088428
Alignment:
267 tccgtttcaaaataagtgttgttttagcaaaaaattgtaaaattattttaaaattaacgtcac-ctcagtttccaatgcaata 348  Q
    ||||||||||||| ||||| |||||||||||||     |||||| ||||||||| ||||||||  | ||||||||||||||||    
50088505 tccgtttcaaaatgagtgtcgttttagcaaaaa-----aaaattgttttaaaatgaacgtcacttttagtttccaatgcaata 50088428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 152
Target Start/End: Original strand, 31106 - 31166
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatat 152  Q
    |||||||||||||||||||||||| |||||| |||||||    || |||||||||||||||    
31106 atttttggaaagagaaaaagtcaggccaaaaaagctgaaggaggttattttctttatatat 31166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0196 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0196
Description:

Target: scaffold0196; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 8450 - 8503
Alignment:
100 aaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||||||| |||  ||||||||||||||| | || ||||||||||||||||    
8450 aaagagaaaaaatcatcccaaaagagctgaaaggggttattttctttatatata 8503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 32397 - 32336
Alignment:
92 atttttggaaagagaaaaagtcagtccaaaagagctgaaatgagtaattttctttatatata 153  Q
    ||||||| ||||||||| |||||   ||||||| || |||||||| ||||||||||||||||    
32397 atttttgaaaagagaaagagtcaactcaaaagaacttaaatgagttattttctttatatata 32336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137001 times since January 2019
Visitors: 1444