View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0110-INSERTION-9 (Length: 100)

Name: NF0110-INSERTION-9
Description: NF0110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0110-INSERTION-9
[»] chr4 (1 HSPs)
chr4 (8-94)||(50407419-50407505)

Alignment Details
Target: chr4 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 50407505 - 50407419
8 gaaggttgcacaaattctccggtagatgagtgtgagttttaccccctcccatacgaggttccacactggaccaacaatgataatatt 94  Q
    ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
50407505 gaaggttgcacaacttctcctgtagatgagtgtgagttttaccccctcccatacgaggtttcacactggaccaacaatgataatatt 50407419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137260 times since January 2019
Visitors: 1446