View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0267_low_3 (Length: 489)

Name: NF0267_low_3
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0267_low_3
[»] chr5 (15 HSPs)
chr5 (1-475)||(3299641-3300115)
chr5 (1-475)||(3392534-3393008)
chr5 (12-352)||(1163333-1163676)
chr5 (1-352)||(40418406-40418758)
chr5 (12-257)||(1850063-1850293)
chr5 (1-352)||(39879943-39880297)
chr5 (1-352)||(38987828-38988180)
chr5 (1-352)||(39726547-39726906)
chr5 (1-127)||(39168975-39169101)
chr5 (384-448)||(1163224-1163288)
chr5 (348-437)||(1850346-1850443)
chr5 (350-431)||(39880327-39880405)
chr5 (350-431)||(40418782-40418860)
chr5 (73-115)||(39400042-39400084)
chr5 (378-431)||(38988229-38988282)
[»] chr4 (5 HSPs)
chr4 (1-132)||(25912122-25912250)
chr4 (208-352)||(44444395-44444543)
chr4 (212-307)||(25911951-25912046)
chr4 (62-122)||(44444614-44444674)
chr4 (395-431)||(25911785-25911821)

Alignment Details
Target: chr5 (Bit Score: 463; Significance: 0; HSPs: 15)
Name: chr5

Target: chr5; HSP #1
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 1 - 475
Target Start/End: Original strand, 3299641 - 3300115
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3299641 ccttcctgctgccattttgatcaccaaaattagttatgccgaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 3299740  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
3299741 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 3299840  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
3299841 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 3299940  T
301 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 400  Q
3299941 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 3300040  T
401 ttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtgcttcccaaaccatgcatgtcattaatt 475  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3300041 ttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtgcttcccaaaccatgcatgtcattaatt 3300115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 1 - 475
Target Start/End: Original strand, 3392534 - 3393008
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3392534 ccttcctgctgccattttgatcaccaaaattagttatgccgaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 3392633  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
3392634 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 3392733  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
3392734 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 3392833  T
301 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 400  Q
3392834 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 3392933  T
401 ttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtgcttcccaaaccatgcatgtcattaatt 475  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3392934 ttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtgcttcccaaaccatgcatgtcattaatt 3393008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 1163676 - 1163333
12 ccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 111  Q
    |||||||||| ||||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
1163676 ccattttgattaccaagattagttttgctaaagaggagaatggtagagttgttcctgttcaggataagtgggaatctggttatcaactcttcttaaaaga 1163577  T
112 tctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaatccccctttaga 211  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||| |||||||||||| || | ||  | ||| ||||||||||       
1163576 tctacaacaagaccctaaactcctcttcgaccaaagagcaatctaccgaaatccaacctactgccatccatctggcccactcttcagatcccccttttat 1163477  T
212 agacctttttatccattggaggatttgcttgatg---gatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataac 308  Q
    |||||||||| |||||||||||||||||||||||   ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1163476 agacctttttttccattggaggatttgcttgatggatgatgatctacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataac 1163377  T
309 caaaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
     ||||||||||||||||||||||||||||||||||||| |||||    
1163376 aaaaacaaggaagatgcttttcatttattagcttttttatattt 1163333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 40418406 - 40418758
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||   |||||||||||||||||| |||| |||||||||||||||||||||||||||    
40418406 ccttcctgctgccattttgatcaccaagattagttatgccgaagag---aatggtagagttgttgctcttcatgataagtgggaatctgattatcaactc 40418502  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatc-aaa 199  Q
    ||||| || |||||||||||||||||||||||||||||| ||  |||||||  ||||||| ||| ||||||  || |  ||| |||     || ||  ||    
40418503 ttcttcaatgatctacaacaagacactaaactcctcttcaacgtaagagcagcctaccgagatcaaaccaaaagctacacatatgatgggcccttcgtaa 40418602  T
200 tccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttact 299  Q
    ||||||  ||  |||||||||  |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | || ||||||||||  |    
40418603 tccccc-ctaccagaccttttgttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttaatgttttgtttgt 40418701  T
300 tccaataac--caaaa--caaggaagatgcttttcatttattagcttttttctattt 352  Q
    |||||||||  |||||  |||||||||||||||||||||||||| || |||||||||    
40418702 tccaataacaacaaaaatcaaggaagatgcttttcatttattaggttctttctattt 40418758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 12 - 257
Target Start/End: Original strand, 1850063 - 1850293
12 ccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 111  Q
    |||||||||| ||||||||||||| |||  |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||    
1850063 ccattttgattaccaagattagttttgctaaagaggagaatggtagagttattcctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 1850162  T
112 tctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaatccccctttaga 211  Q
    | ||||||||||| |||||||||||||||               ||||||||| ||||||||||||||||| || | || |||||| |||||| ||||||    
1850163 tttacaacaagaccctaaactcctcttcg---------------accgaaatccaaccaactgccatccatctggcccacccatcagatccccttttaga 1850247  T
212 agacctttttatccattggaggatttgcttgatggatgatccactt 257  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||    
1850248 agacctttttatccattggaggatttgcttgatggatgatctactt 1850293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 39879943 - 39880297
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
39879943 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 39880039  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatca-aa 199  Q
    ||||| || |||||||||||| ||||||||||| |||||  |  |||||||  ||||||| ||| ||||||  || |  ||| |||     || ||| ||    
39880040 ttcttcaatgatctacaacaaaacactaaactcatcttcagcgtaagagcagcctaccgagatcaaaccaaaagctacacatatgatgggcccttcagaa 39880139  T
200 tccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttact 299  Q
    ||||||  ||  |||||||||| |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | |||||||||| ||  |    
39880140 tccccc-ctaccagacctttttttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttgatgtttt-tttgt 39880237  T
300 tccaataacca-------aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
    ||||||||  |       || |||||||||||||||||||||||||| || |||||||||    
39880238 tccaataataacaacaacaatcaaggaagatgcttttcatttattaggttctttctattt 39880297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 38987828 - 38988180
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
38987828 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 38987924  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||| || ||||||||||||||| || |||| |||||| |   || ||||  ||||||||||| || ||||  | |  ||| ||||    || ||  |     
38987925 ttcttcaatgatctacaacaagaccctcaactactcttcaagataacagcagcctaccgaaatccaaacaaccactacacatatgacgggcccttcgtag 38988024  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
     ||||  ||  ||||||||| ||||||||||||| |||||||| |||||||| | | || |||||||||||| ||||||| | |||||||||||||  ||    
38988025 acccccctaccagaccttttgatccattggaggacttgcttgacggatgatctagtcactagcttaaacaaaaatcacttttgttgatgttttgtttgtt 38988124  T
301 ccaataacca----aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
    |||||||| |    || |||||||| |||| |||||||||||| || |||||||||    
38988125 ccaataacaacaacaatcaaggaagctgctcttcatttattaggttctttctattt 38988180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 39726547 - 39726906
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
39726547 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 39726643  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||| || ||||||||||||||| || |||| |||||| |   || ||||  ||||||||||| || ||||  | |  ||| ||||    || ||  |     
39726644 ttcttcaatgatctacaacaagaccctcaactactcttcaagataacagcaccctaccgaaatccaaacaaccactacacatatgacgggcccttcgtag 39726743  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgat----ccacttacaagcttaaacaaacatcacttctattgatgttttgtt 296  Q
     ||||  ||  ||||||||| ||||||||||||| |||||||| |||||||    | | |||| |||||||||||| ||||| | | |||||||||||||    
39726744 acccccctatcagaccttttgatccattggaggacttgcttgacggatgatctagctagttactagcttaaacaaaaatcacctttgttgatgttttgtt 39726843  T
297 acttccaataacca-------aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
      |||||||||  |       || |||||||||||||||||||||||||| || |||||||||    
39726844 tgttccaataataacaacaacaatcaaggaagatgcttttcatttattaggttctttctattt 39726906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 39168975 - 39169101
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtaga---gttgttgctgttcaggataagtgggaatctgattatcaa 97  Q
    |||||||||||| |||||||| ||||||| ||||||||   | || || |||||||||   ||||||| |||| ||| ||||||||||||||||||||||    
39168975 ccttcctgctgcaattttgattaccaagagtagttatg---atgaagaaaatggtagaattgttgttgttgttgagggtaagtgggaatctgattatcaa 39169071  T
98 ctcttcttaaaagatctacaacaagacact 127  Q
    ||||| ||||||||||||||||||||||||    
39169072 ctctttttaaaagatctacaacaagacact 39169101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 384 - 448
Target Start/End: Complemental strand, 1163288 - 1163224
384 acttactctgttgcaatttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtg 448  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
1163288 acttactttgttgcaatttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtg 1163224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 348 - 437
Target Start/End: Original strand, 1850346 - 1850443
348 tatttattccgataacaagaacaacta--------gttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttattagaaca 437  Q
    |||||||||||||||||||||||| ||        |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
1850346 tatttattccgataacaagaacaaatacttaaaaggttcttttcacttactttgttgcaatttacaatttctgtttgatatttatgtttattagaaca 1850443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 350 - 431
Target Start/End: Original strand, 39880327 - 39880405
350 tttattccgataacaagaacaactagttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||| || ||||||||||   || |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
39880327 tttattccaatgacaagaacaa---gtgcttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 39880405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 350 - 431
Target Start/End: Original strand, 40418782 - 40418860
350 tttattccgataacaagaacaactagttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||| || ||||||||||   || |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
40418782 tttattccaatgacaagaacaa---gtgcttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 40418860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 73 - 115
Target Start/End: Original strand, 39400042 - 39400084
73 ggataagtgggaatctgattatcaactcttcttaaaagatcta 115  Q
    |||||||||| ||||||||||||||||||||||| ||||||||    
39400042 ggataagtggcaatctgattatcaactcttcttagaagatcta 39400084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 378 - 431
Target Start/End: Original strand, 38988229 - 38988282
378 cttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
38988229 cttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 38988282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 1e-45; HSPs: 5)
Name: chr4

Target: chr4; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 25912250 - 25912122
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||   |||||||||||||||||||||||||||||||||||||||||||||||||||    
25912250 ccttcatgctgccattttgatcaccaagattagttatgccgaagag---aatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 25912154  T
101 ttcttaaaagatctacaacaagacactaaact 132  Q
    ||||||||  ||||||| |||||| |||||||    
25912153 ttcttaaattatctacagcaagaccctaaact 25912122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 208 - 352
Target Start/End: Complemental strand, 44444543 - 44444395
208 tagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataa 307  Q
    ||||||| |||||  |||||| ||||| |||||||| |||||||| | ||||||||||||||||| ||||||| | |||||||||||||   ||||||||    
44444543 tagaagatcttttgttccattagaggacttgcttgacggatgatctagttacaagcttaaacaaaaatcacttttgttgatgttttgtttactccaataa 44444444  T
308 ccaaaa----caaggaagatgcttttcatttattagcttttttctattt 352  Q
    | ||||    ||||||| |||| ||||||||||||| || |||||||||    
44444443 cgaaaacaatcaaggaatatgcctttcatttattaggttatttctattt 44444395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 212 - 307
Target Start/End: Complemental strand, 25912046 - 25911951
212 agacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataa 307  Q
    |||||||||  |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | |||||||||||||  |||||||||    
25912046 agaccttttgttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttgatgttttgtttgttccaataa 25911951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 44444674 - 44444614
62 gttgctgttcaggataagtgggaatctgattatcaactcttcttaaaagatctacaacaag 122  Q
    |||| |||||||||||| | ||||||||||||| |||| ||||||||| ||||| ||||||    
44444674 gttgttgttcaggataaattggaatctgattataaacttttcttaaaatatctaaaacaag 44444614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 395 - 431
Target Start/End: Complemental strand, 25911821 - 25911785
395 tgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||| |||||||||||||||||||| |||||||||||    
25911821 tgcagtttgcaatttctgtttgatacttatgtttatt 25911785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191911 times since January 2019
Visitors: 2831