View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0267_low_3 (Length: 489)

Name: NF0267_low_3
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0267_low_3
NF0267_low_3
[»] chr5 (15 HSPs)
chr5 (1-475)||(3299641-3300115)
chr5 (1-475)||(3392534-3393008)
chr5 (12-352)||(1163333-1163676)
chr5 (1-352)||(40418406-40418758)
chr5 (12-257)||(1850063-1850293)
chr5 (1-352)||(39879943-39880297)
chr5 (1-352)||(38987828-38988180)
chr5 (1-352)||(39726547-39726906)
chr5 (1-127)||(39168975-39169101)
chr5 (384-448)||(1163224-1163288)
chr5 (348-437)||(1850346-1850443)
chr5 (350-431)||(39880327-39880405)
chr5 (350-431)||(40418782-40418860)
chr5 (73-115)||(39400042-39400084)
chr5 (378-431)||(38988229-38988282)
[»] chr4 (5 HSPs)
chr4 (1-132)||(25912122-25912250)
chr4 (208-352)||(44444395-44444543)
chr4 (212-307)||(25911951-25912046)
chr4 (62-122)||(44444614-44444674)
chr4 (395-431)||(25911785-25911821)


Alignment Details
Target: chr5 (Bit Score: 463; Significance: 0; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 1 - 475
Target Start/End: Original strand, 3299641 - 3300115
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3299641 ccttcctgctgccattttgatcaccaaaattagttatgccgaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 3299740  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3299741 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 3299840  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3299841 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 3299940  T
301 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3299941 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 3300040  T
401 ttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtgcttcccaaaccatgcatgtcattaatt 475  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3300041 ttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtgcttcccaaaccatgcatgtcattaatt 3300115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 463; E-Value: 0
Query Start/End: Original strand, 1 - 475
Target Start/End: Original strand, 3392534 - 3393008
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3392534 ccttcctgctgccattttgatcaccaaaattagttatgccgaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 3392633  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3392634 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 3392733  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3392734 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 3392833  T
301 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3392834 ccaataaccaaaacaaggaagatgcttttcatttattagcttttttctatttattccgataacaagaacaactagttcttttcacttactctgttgcaat 3392933  T
401 ttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtgcttcccaaaccatgcatgtcattaatt 475  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3392934 ttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtgcttcccaaaccatgcatgtcattaatt 3393008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 352
Target Start/End: Complemental strand, 1163676 - 1163333
Alignment:
12 ccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 111  Q
    |||||||||| ||||||||||||| |||  ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
1163676 ccattttgattaccaagattagttttgctaaagaggagaatggtagagttgttcctgttcaggataagtgggaatctggttatcaactcttcttaaaaga 1163577  T
112 tctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaatccccctttaga 211  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||| |||||||||||| || | ||  | ||| ||||||||||       
1163576 tctacaacaagaccctaaactcctcttcgaccaaagagcaatctaccgaaatccaacctactgccatccatctggcccactcttcagatcccccttttat 1163477  T
212 agacctttttatccattggaggatttgcttgatg---gatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataac 308  Q
    |||||||||| |||||||||||||||||||||||   ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1163476 agacctttttttccattggaggatttgcttgatggatgatgatctacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataac 1163377  T
309 caaaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
     ||||||||||||||||||||||||||||||||||||| |||||    
1163376 aaaaacaaggaagatgcttttcatttattagcttttttatattt 1163333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 40418406 - 40418758
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||   |||||||||||||||||| |||| |||||||||||||||||||||||||||    
40418406 ccttcctgctgccattttgatcaccaagattagttatgccgaagag---aatggtagagttgttgctcttcatgataagtgggaatctgattatcaactc 40418502  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatc-aaa 199  Q
    ||||| || |||||||||||||||||||||||||||||| ||  |||||||  ||||||| ||| ||||||  || |  ||| |||     || ||  ||    
40418503 ttcttcaatgatctacaacaagacactaaactcctcttcaacgtaagagcagcctaccgagatcaaaccaaaagctacacatatgatgggcccttcgtaa 40418602  T
200 tccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttact 299  Q
    ||||||  ||  |||||||||  |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | || ||||||||||  |    
40418603 tccccc-ctaccagaccttttgttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttaatgttttgtttgt 40418701  T
300 tccaataac--caaaa--caaggaagatgcttttcatttattagcttttttctattt 352  Q
    |||||||||  |||||  |||||||||||||||||||||||||| || |||||||||    
40418702 tccaataacaacaaaaatcaaggaagatgcttttcatttattaggttctttctattt 40418758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 12 - 257
Target Start/End: Original strand, 1850063 - 1850293
Alignment:
12 ccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 111  Q
    |||||||||| ||||||||||||| |||  |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||    
1850063 ccattttgattaccaagattagttttgctaaagaggagaatggtagagttattcctgttcaggataagtgggaatctgattatcaactcttcttaaaaga 1850162  T
112 tctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaatccccctttaga 211  Q
    | ||||||||||| |||||||||||||||               ||||||||| ||||||||||||||||| || | || |||||| |||||| ||||||    
1850163 tttacaacaagaccctaaactcctcttcg---------------accgaaatccaaccaactgccatccatctggcccacccatcagatccccttttaga 1850247  T
212 agacctttttatccattggaggatttgcttgatggatgatccactt 257  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||    
1850248 agacctttttatccattggaggatttgcttgatggatgatctactt 1850293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 39879943 - 39880297
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
39879943 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 39880039  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatca-aa 199  Q
    ||||| || |||||||||||| ||||||||||| |||||  |  |||||||  ||||||| ||| ||||||  || |  ||| |||     || ||| ||    
39880040 ttcttcaatgatctacaacaaaacactaaactcatcttcagcgtaagagcagcctaccgagatcaaaccaaaagctacacatatgatgggcccttcagaa 39880139  T
200 tccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttact 299  Q
    ||||||  ||  |||||||||| |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | |||||||||| ||  |    
39880140 tccccc-ctaccagacctttttttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttgatgtttt-tttgt 39880237  T
300 tccaataacca-------aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
    ||||||||  |       || |||||||||||||||||||||||||| || |||||||||    
39880238 tccaataataacaacaacaatcaaggaagatgcttttcatttattaggttctttctattt 39880297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 38987828 - 38988180
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
38987828 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 38987924  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||| || ||||||||||||||| || |||| |||||| |   || ||||  ||||||||||| || ||||  | |  ||| ||||    || ||  |     
38987925 ttcttcaatgatctacaacaagaccctcaactactcttcaagataacagcagcctaccgaaatccaaacaaccactacacatatgacgggcccttcgtag 38988024  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttactt 300  Q
     ||||  ||  ||||||||| ||||||||||||| |||||||| |||||||| | | || |||||||||||| ||||||| | |||||||||||||  ||    
38988025 acccccctaccagaccttttgatccattggaggacttgcttgacggatgatctagtcactagcttaaacaaaaatcacttttgttgatgttttgtttgtt 38988124  T
301 ccaataacca----aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
    |||||||| |    || |||||||| |||| |||||||||||| || |||||||||    
38988125 ccaataacaacaacaatcaaggaagctgctcttcatttattaggttctttctattt 38988180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 39726547 - 39726906
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||||||||||||||||||||| |||||||||||||||| ||| |   ||||||||||||||||||||  |||||||||||||||||||||||||||||    
39726547 ccttcctgctgccattttgatcagcaagattagttatgccgaagtg---aatggtagagttgttgctgtcaaggataagtgggaatctgattatcaactc 39726643  T
101 ttcttaaaagatctacaacaagacactaaactcctcttcgaccgaagagcaatctaccgaaatcgaaccaactgccatccatttgacacaaccatcaaat 200  Q
    ||||| || ||||||||||||||| || |||| |||||| |   || ||||  ||||||||||| || ||||  | |  ||| ||||    || ||  |     
39726644 ttcttcaatgatctacaacaagaccctcaactactcttcaagataacagcaccctaccgaaatccaaacaaccactacacatatgacgggcccttcgtag 39726743  T
201 ccccctttagaagacctttttatccattggaggatttgcttgatggatgat----ccacttacaagcttaaacaaacatcacttctattgatgttttgtt 296  Q
     ||||  ||  ||||||||| ||||||||||||| |||||||| |||||||    | | |||| |||||||||||| ||||| | | |||||||||||||    
39726744 acccccctatcagaccttttgatccattggaggacttgcttgacggatgatctagctagttactagcttaaacaaaaatcacctttgttgatgttttgtt 39726843  T
297 acttccaataacca-------aaacaaggaagatgcttttcatttattagcttttttctattt 352  Q
      |||||||||  |       || |||||||||||||||||||||||||| || |||||||||    
39726844 tgttccaataataacaacaacaatcaaggaagatgcttttcatttattaggttctttctattt 39726906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 39168975 - 39169101
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtaga---gttgttgctgttcaggataagtgggaatctgattatcaa 97  Q
    |||||||||||| |||||||| ||||||| ||||||||   | || || |||||||||   ||||||| |||| ||| ||||||||||||||||||||||    
39168975 ccttcctgctgcaattttgattaccaagagtagttatg---atgaagaaaatggtagaattgttgttgttgttgagggtaagtgggaatctgattatcaa 39169071  T
98 ctcttcttaaaagatctacaacaagacact 127  Q
    ||||| ||||||||||||||||||||||||    
39169072 ctctttttaaaagatctacaacaagacact 39169101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 384 - 448
Target Start/End: Complemental strand, 1163288 - 1163224
Alignment:
384 acttactctgttgcaatttgcaatttctgtttgatatttatgtttattagaacaggttatgtgtg 448  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
1163288 acttactttgttgcaatttgcaatttctgtttgatatttatgtttattagaacaagttatgtgtg 1163224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 348 - 437
Target Start/End: Original strand, 1850346 - 1850443
Alignment:
348 tatttattccgataacaagaacaacta--------gttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttattagaaca 437  Q
    |||||||||||||||||||||||| ||        |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||    
1850346 tatttattccgataacaagaacaaatacttaaaaggttcttttcacttactttgttgcaatttacaatttctgtttgatatttatgtttattagaaca 1850443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 350 - 431
Target Start/End: Original strand, 39880327 - 39880405
Alignment:
350 tttattccgataacaagaacaactagttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||| || ||||||||||   || |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
39880327 tttattccaatgacaagaacaa---gtgcttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 39880405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 350 - 431
Target Start/End: Original strand, 40418782 - 40418860
Alignment:
350 tttattccgataacaagaacaactagttcttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||| || ||||||||||   || |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
40418782 tttattccaatgacaagaacaa---gtgcttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 40418860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 73 - 115
Target Start/End: Original strand, 39400042 - 39400084
Alignment:
73 ggataagtgggaatctgattatcaactcttcttaaaagatcta 115  Q
    |||||||||| ||||||||||||||||||||||| ||||||||    
39400042 ggataagtggcaatctgattatcaactcttcttagaagatcta 39400084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 378 - 431
Target Start/End: Original strand, 38988229 - 38988282
Alignment:
378 cttttcacttactctgttgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||||||||||   || |||| ||||||||||||||||||||||||||||||||    
38988229 cttttcacttaggttgctgcagtttgcaatttctgtttgatatttatgtttatt 38988282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 94; Significance: 1e-45; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 25912250 - 25912122
Alignment:
1 ccttcctgctgccattttgatcaccaagattagttatgcccaagaggagaatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 100  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||   |||||||||||||||||||||||||||||||||||||||||||||||||||    
25912250 ccttcatgctgccattttgatcaccaagattagttatgccgaagag---aatggtagagttgttgctgttcaggataagtgggaatctgattatcaactc 25912154  T
101 ttcttaaaagatctacaacaagacactaaact 132  Q
    ||||||||  ||||||| |||||| |||||||    
25912153 ttcttaaattatctacagcaagaccctaaact 25912122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 208 - 352
Target Start/End: Complemental strand, 44444543 - 44444395
Alignment:
208 tagaagacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataa 307  Q
    ||||||| |||||  |||||| ||||| |||||||| |||||||| | ||||||||||||||||| ||||||| | |||||||||||||   ||||||||    
44444543 tagaagatcttttgttccattagaggacttgcttgacggatgatctagttacaagcttaaacaaaaatcacttttgttgatgttttgtttactccaataa 44444444  T
308 ccaaaa----caaggaagatgcttttcatttattagcttttttctattt 352  Q
    | ||||    ||||||| |||| ||||||||||||| || |||||||||    
44444443 cgaaaacaatcaaggaatatgcctttcatttattaggttatttctattt 44444395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 212 - 307
Target Start/End: Complemental strand, 25912046 - 25911951
Alignment:
212 agacctttttatccattggaggatttgcttgatggatgatccacttacaagcttaaacaaacatcacttctattgatgttttgttacttccaataa 307  Q
    |||||||||  |||||||||||| |||||||| |||||||| | |||| |||||||||||| ||||||| | |||||||||||||  |||||||||    
25912046 agaccttttgttccattggaggacttgcttgacggatgatctagttactagcttaaacaaaaatcacttttgttgatgttttgtttgttccaataa 25911951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 44444674 - 44444614
Alignment:
62 gttgctgttcaggataagtgggaatctgattatcaactcttcttaaaagatctacaacaag 122  Q
    |||| |||||||||||| | ||||||||||||| |||| ||||||||| ||||| ||||||    
44444674 gttgttgttcaggataaattggaatctgattataaacttttcttaaaatatctaaaacaag 44444614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 395 - 431
Target Start/End: Complemental strand, 25911821 - 25911785
Alignment:
395 tgcaatttgcaatttctgtttgatatttatgtttatt 431  Q
    |||| |||||||||||||||||||| |||||||||||    
25911821 tgcagtttgcaatttctgtttgatacttatgtttatt 25911785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125390 times since January 2019
Visitors: 1457