View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-1 (Length: 50)

Name: NF0440-3-1-Insertion-1
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-1
NF0440-3-1-Insertion-1
[»] chr8 (1 HSPs)
chr8 (5-50)||(43068838-43068883)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 8e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 8e-16
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 43068883 - 43068838
Alignment:
5 tgatgatgatgaagatgacaaactagaagttgaagaggatacttct 50  Q
    |||||||||||||||||||||||||||||||||||||||| |||||    
43068883 tgatgatgatgaagatgacaaactagaagttgaagaggatgcttct 43068838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC