View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-10 (Length: 140)

Name: NF0440-3-1-Insertion-10
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-10
NF0440-3-1-Insertion-10
[»] chr8 (1 HSPs)
chr8 (1-140)||(40363225-40363364)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 40363225 - 40363364
Alignment:
1 gcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcactggataatcctctggcgttcaatggatgtagcaaagaaatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40363225 gcatattagtacaatattttaatcatagctaggaaatatgcaagcatctaatacatcactggataatcctctggcgttcaatggatgtagcaaagaaatg 40363324  T
101 gaaattaactgattcagagtattcactacttagttaaaaa 140  Q
    |||||||||||||| ||| |||||||||||||||||||||    
40363325 gaaattaactgattaagaatattcactacttagttaaaaa 40363364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC