View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-12 (Length: 131)

Name: NF0440-3-1-Insertion-12
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-12
[»] chr4 (1 HSPs)
chr4 (1-131)||(53007063-53007193)

Alignment Details
Target: chr4 (Bit Score: 127; Significance: 5e-66; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 127; E-Value: 5e-66
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 53007193 - 53007063
1 tctcgtgtatgaggtgttggaaatgatttttattccaaaaggatgaattggaagcataaatctttagtttatccggaaattgttagttcccatatgaact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
53007193 tctcgtgtatgaggtgttggaaatgatttttattccaaaaggatgaattggaagcataaatctttagtttatccgaaaattgttagttcccatatgaact 53007094  T
101 ccaacaatcatgaacaaaatcacaaaaatca 131  Q
53007093 ccaacaatcatgaacaaaatcacaaaaatca 53007063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC