View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-13 (Length: 124)

Name: NF0440-3-1-Insertion-13
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-13
NF0440-3-1-Insertion-13
[»] chr4 (1 HSPs)
chr4 (1-122)||(6004337-6004458)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 6004337 - 6004458
Alignment:
1 cacataaaagtaatgcttttgtcttgtcacaaaaacatataatgcatttttatatcgagtccatcaatttatgttctatggaataaaaagataacaaaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6004337 cacataaaagtaatgcttttgtcttgtcacaaaaacatataatgcatttttatatcgagtccatcaatttatgttctatggaataaaaagataacaaaag 6004436  T
101 agaactacaagaaccatccgtc 122  Q
    ||||||||||||||||||||||    
6004437 agaactacaagaaccatccgtc 6004458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98200 times since January 2019
Visitors: 2269