View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-16 (Length: 91)

Name: NF0440-3-1-Insertion-16
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-16
[»] chr7 (1 HSPs)
chr7 (1-91)||(7088389-7088479)

Alignment Details
Target: chr7 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7088479 - 7088389
1 ctttgttgaatagtgttgatctntcaaataatcattttagtggtaatgttgatttttctagtgtttggtcattgaataggcttagaagctt 91  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
7088479 ctttgttgaatagtgttgatctttcaaataatcattttagtggtaatgttgatttttctagggtttggtcattgaataggcttagaagctt 7088389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC