View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-17 (Length: 85)

Name: NF0440-3-1-Insertion-17
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-17
NF0440-3-1-Insertion-17
[»] chr7 (1 HSPs)
chr7 (1-85)||(43699281-43699365)
[»] chr2 (1 HSPs)
chr2 (46-85)||(45514083-45514122)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 43699365 - 43699281
Alignment:
1 ctttgtggatactagaggttgggaacagatggagggacaacccaatgataaggttacttatgtggagtttgagaatgttggacct 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43699365 ctttgtggatactagaggttgggaacagatggagggacaacccaatgataaggttacttatgtggagtttgagaatgttggacct 43699281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 85
Target Start/End: Complemental strand, 45514122 - 45514083
Alignment:
46 tgataaggttacttatgtggagtttgagaatgttggacct 85  Q
    |||||| ||||||||||| |||||||||||||||||||||    
45514122 tgataaagttacttatgttgagtttgagaatgttggacct 45514083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC