View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-19 (Length: 105)

Name: NF0440-3-1-Insertion-19
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-19
[»] chr8 (1 HSPs)
chr8 (1-105)||(40534114-40534218)

Alignment Details
Target: chr8 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 40534114 - 40534218
1 gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc 100  Q
40534114 gtaatgtagttagctttaaattaccatgagaggtctccaattggtgatatcagttacaccttcaaacatcatggcagcactaattgcagcattgtttacc 40534213  T
101 aaatg 105  Q
40534214 aaatg 40534218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84097 times since January 2019
Visitors: 2323