View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-2 (Length: 315)

Name: NF0440-3-1-Insertion-2
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-2
NF0440-3-1-Insertion-2
[»] chr8 (3 HSPs)
chr8 (6-315)||(263083-263402)
chr8 (6-315)||(652519-652838)
chr8 (6-315)||(838254-838573)


Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 6 - 315
Target Start/End: Complemental strand, 263402 - 263083
Alignment:
6 aatatgacggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 105  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
263402 aatatggcggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 263303  T
106 ttttagttggtgaataataaggtgaattatttggaacatgagtgattta----------ccgtggaaattagatttgaagatactggtcaatactcacaa 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||    
263302 ttttagttggtgaataataaggtgaattatttggaacatgagtgatttagcgcattcccccgtggaaattagatttgaagatactggtcaatactcacaa 263203  T
196 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
263202 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 263103  T
296 gtattatatacacatgagta 315  Q
    ||||||||||||||||||||    
263102 gtattatatacacatgagta 263083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 6 - 315
Target Start/End: Original strand, 652519 - 652838
Alignment:
6 aatatgacggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 105  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
652519 aatatggcggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 652618  T
106 ttttagttggtgaataataaggtgaattatttggaacatgagtgattta----------ccgtggaaattagatttgaagatactggtcaatactcacaa 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||    
652619 ttttagttggtgaataataaggtgaattatttggaacatgagtgatttagcgcattcccccgtggaaattagatttgaagatactggtcaatactcacaa 652718  T
196 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
652719 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 652818  T
296 gtattatatacacatgagta 315  Q
    ||||||||||||||||||||    
652819 gtattatatacacatgagta 652838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 6 - 315
Target Start/End: Original strand, 838254 - 838573
Alignment:
6 aatatgacggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 105  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
838254 aatatggcggaaaatgaagagattgaggtaaatggtaatgttggaaatattgaaacaagaacacttaaagaggaacacattaagggtgaataataaatag 838353  T
106 ttttagttggtgaataataaggtgaattatttggaacatgagtgattta----------ccgtggaaattagatttgaagatactggtcaatactcacaa 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||    
838354 ttttagttggtgaataataaggtgaattatttggaacatgagtgatttagcgcattcccccgtggaaattagatttgaagatactggtcaatactcacaa 838453  T
196 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 295  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
838454 acttggtttagcacttatttcaattctatggattaactcttaggctttcccaaaaatatggctaactagacttaacctaaagttgttttctacggtgtct 838553  T
296 gtattatatacacatgagta 315  Q
    ||||||||||||||||||||    
838554 gtattatatacacatgagta 838573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC