View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-21 (Length: 90)

Name: NF0440-3-1-Insertion-21
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-21
NF0440-3-1-Insertion-21
[»] chr8 (1 HSPs)
chr8 (1-90)||(37768421-37768510)
[»] chr4 (1 HSPs)
chr4 (1-38)||(22393896-22393933)
[»] chr5 (1 HSPs)
chr5 (42-90)||(42504298-42504346)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 4e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 4e-44
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 37768421 - 37768510
Alignment:
1 aaaacatcaattagggatttttagactttatctcaacaactaatgagttttatccaaatataatttataatagaatattatgacgtaatt 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37768421 aaaacatcaattagggatttttagactttatctcaacaactaatgagttttatccaaatataatttataatagaatattatgacgtaatt 37768510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 22393933 - 22393896
Alignment:
1 aaaacatcaattagggatttttagactttatctcaaca 38  Q
    ||||||||||||| ||||||||||| ||||||||||||    
22393933 aaaacatcaattaaggatttttagattttatctcaaca 22393896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 90
Target Start/End: Complemental strand, 42504346 - 42504298
Alignment:
42 aatgagttttatccaaatataatttataatagaatattatgacgtaatt 90  Q
    |||||||| |||||||||||  ||||| |||||| ||||||||||||||    
42504346 aatgagttatatccaaatatggtttatgatagaacattatgacgtaatt 42504298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 78128 times since January 2019
Visitors: 2276