View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-23 (Length: 78)

Name: NF0440-3-1-Insertion-23
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-23
NF0440-3-1-Insertion-23
[»] chr3 (61 HSPs)
chr3 (1-78)||(32633323-32633400)
chr3 (4-78)||(22151963-22152037)
chr3 (4-78)||(44893858-44893932)
chr3 (4-78)||(8474104-8474178)
chr3 (4-78)||(10506206-10506280)
chr3 (4-78)||(21969747-21969821)
chr3 (4-78)||(21992183-21992257)
chr3 (4-78)||(26318440-26318514)
chr3 (4-78)||(39241476-39241550)
chr3 (4-78)||(42591902-42591976)
chr3 (4-78)||(47669377-47669451)
chr3 (4-78)||(54108160-54108234)
chr3 (4-78)||(54752281-54752355)
chr3 (1-78)||(39951472-39951549)
chr3 (10-78)||(12203809-12203877)
chr3 (4-78)||(1994426-1994500)
chr3 (4-78)||(4757751-4757825)
chr3 (4-78)||(5900681-5900755)
chr3 (4-78)||(15986353-15986427)
chr3 (4-78)||(39664442-39664516)
chr3 (10-78)||(11256227-11256295)
chr3 (11-78)||(22201741-22201808)
chr3 (4-78)||(16931724-16931798)
chr3 (4-78)||(27801607-27801681)
chr3 (4-78)||(29818295-29818369)
chr3 (4-78)||(51509377-51509451)
chr3 (1-78)||(18464571-18464648)
chr3 (10-78)||(28986400-28986468)
chr3 (4-78)||(53716412-53716485)
chr3 (4-78)||(47303277-47303348)
chr3 (4-78)||(4773361-4773434)
chr3 (4-78)||(21568864-21568937)
chr3 (10-78)||(24428691-24428759)
chr3 (10-78)||(41835184-41835252)
chr3 (4-78)||(46152733-46152805)
chr3 (4-48)||(12203669-12203713)
chr3 (10-78)||(19883363-19883431)
chr3 (4-48)||(54108020-54108064)
chr3 (4-48)||(54752451-54752495)
chr3 (1-48)||(24428855-24428902)
chr3 (6-48)||(19883528-19883570)
chr3 (1-46)||(44894030-44894075)
chr3 (4-48)||(4757612-4757656)
chr3 (4-48)||(27801777-27801821)
chr3 (4-48)||(28986278-28986322)
chr3 (4-48)||(39241646-39241690)
chr3 (4-48)||(39664302-39664346)
chr3 (4-47)||(47669548-47669591)
chr3 (1-48)||(51509234-51509281)
chr3 (1-48)||(53716581-53716628)
chr3 (4-45)||(8473964-8474005)
chr3 (4-45)||(26318300-26318341)
chr3 (4-48)||(21569033-21569077)
chr3 (4-48)||(21969917-21969961)
chr3 (4-48)||(21992353-21992397)
chr3 (4-48)||(22152133-22152177)
chr3 (4-48)||(29818465-29818509)
chr3 (1-45)||(46152904-46152948)
chr3 (4-48)||(47303137-47303181)
chr3 (1-48)||(4773530-4773577)
chr3 (4-39)||(12791473-12791508)
[»] chr8 (39 HSPs)
chr8 (4-78)||(7949530-7949604)
chr8 (4-78)||(38588705-38588779)
chr8 (1-78)||(7535091-7535168)
chr8 (10-78)||(45077461-45077529)
chr8 (4-78)||(5435158-5435232)
chr8 (4-78)||(15871879-15871953)
chr8 (4-77)||(18298488-18298561)
chr8 (4-78)||(5152792-5152866)
chr8 (4-78)||(15048517-15048591)
chr8 (4-78)||(27473329-27473403)
chr8 (4-78)||(33295942-33296016)
chr8 (4-78)||(45276854-45276928)
chr8 (4-78)||(1432249-1432323)
chr8 (4-78)||(27669534-27669608)
chr8 (5-78)||(44594859-44594932)
chr8 (1-76)||(11173894-11173969)
chr8 (5-78)||(37569573-37569646)
chr8 (4-78)||(40048177-40048247)
chr8 (4-78)||(1646765-1646838)
chr8 (4-78)||(1651830-1651903)
chr8 (4-78)||(1740206-1740279)
chr8 (4-78)||(1870051-1870125)
chr8 (1-48)||(45077317-45077364)
chr8 (1-48)||(15871736-15871783)
chr8 (1-48)||(38588875-38588922)
chr8 (10-48)||(33819909-33819947)
chr8 (4-48)||(5152652-5152696)
chr8 (4-48)||(5435018-5435062)
chr8 (4-48)||(34470832-34470876)
chr8 (4-48)||(40048342-40048386)
chr8 (4-47)||(1870224-1870267)
chr8 (19-78)||(11708008-11708067)
chr8 (4-45)||(15048690-15048731)
chr8 (4-48)||(7534951-7534995)
chr8 (4-48)||(27473189-27473233)
chr8 (4-48)||(37569432-37569476)
chr8 (10-46)||(40660107-40660143)
chr8 (4-43)||(40660179-40660218)
chr8 (1-48)||(45276712-45276759)
[»] chr7 (39 HSPs)
chr7 (4-78)||(10526429-10526503)
chr7 (1-78)||(28286375-28286452)
chr7 (4-78)||(28297937-28298011)
chr7 (4-78)||(33716706-33716780)
chr7 (4-78)||(41191943-41192017)
chr7 (4-78)||(44332777-44332851)
chr7 (1-70)||(40673271-40673340)
chr7 (4-75)||(1114172-1114243)
chr7 (4-78)||(6356883-6356957)
chr7 (4-78)||(17359299-17359373)
chr7 (4-78)||(34037169-34037243)
chr7 (4-78)||(36423487-36423561)
chr7 (4-78)||(48626321-48626395)
chr7 (13-78)||(7579130-7579195)
chr7 (10-78)||(19681753-19681821)
chr7 (10-78)||(31638201-31638269)
chr7 (4-74)||(8937111-8937181)
chr7 (4-78)||(41453263-41453337)
chr7 (4-61)||(7909404-7909461)
chr7 (4-78)||(6356404-6356477)
chr7 (4-78)||(8542617-8542691)
chr7 (4-78)||(21391448-21391522)
chr7 (4-66)||(27738935-27738997)
chr7 (4-78)||(41751768-41751842)
chr7 (10-78)||(43247540-43247607)
chr7 (4-48)||(28298107-28298151)
chr7 (4-46)||(21391308-21391350)
chr7 (4-48)||(36423657-36423701)
chr7 (1-48)||(17750050-17750097)
chr7 (4-48)||(7578990-7579034)
chr7 (4-48)||(28286235-28286279)
chr7 (4-48)||(35146817-35146861)
chr7 (4-48)||(41191800-41191844)
chr7 (1-48)||(33716872-33716919)
chr7 (4-53)||(4931556-4931605)
chr7 (4-45)||(48626181-48626222)
chr7 (4-48)||(1114333-1114377)
chr7 (4-48)||(8936967-8937011)
chr7 (4-48)||(10526598-10526642)
[»] chr4 (62 HSPs)
chr4 (4-78)||(21763439-21763513)
chr4 (10-78)||(1433529-1433597)
chr4 (4-78)||(19088599-19088673)
chr4 (4-78)||(19508671-19508745)
chr4 (4-78)||(24898307-24898381)
chr4 (4-78)||(30683786-30683860)
chr4 (4-78)||(33091711-33091785)
chr4 (4-78)||(42855597-42855671)
chr4 (4-78)||(46849927-46850001)
chr4 (1-78)||(6712078-6712155)
chr4 (5-78)||(38339611-38339684)
chr4 (1-78)||(44957504-44957581)
chr4 (4-78)||(8592087-8592161)
chr4 (4-78)||(14985449-14985523)
chr4 (4-78)||(15477903-15477977)
chr4 (4-78)||(16038052-16038126)
chr4 (4-78)||(37206685-37206759)
chr4 (4-78)||(39448746-39448820)
chr4 (4-78)||(43734544-43734618)
chr4 (4-78)||(44991536-44991610)
chr4 (4-78)||(50508715-50508789)
chr4 (4-78)||(52557345-52557419)
chr4 (4-78)||(53259396-53259470)
chr4 (4-78)||(53751160-53751234)
chr4 (10-78)||(12817930-12817998)
chr4 (10-78)||(50768945-50769013)
chr4 (4-78)||(623937-624011)
chr4 (4-78)||(25182070-25182144)
chr4 (4-78)||(41752074-41752148)
chr4 (1-78)||(53995192-53995268)
chr4 (10-78)||(36122691-36122759)
chr4 (4-78)||(23756058-23756132)
chr4 (4-78)||(43566636-43566710)
chr4 (10-78)||(41878117-41878185)
chr4 (1-48)||(36122548-36122595)
chr4 (4-48)||(52557205-52557249)
chr4 (10-48)||(21763305-21763343)
chr4 (10-48)||(53995058-53995096)
chr4 (4-49)||(12818093-12818138)
chr4 (1-46)||(23755533-23755578)
chr4 (4-48)||(14985619-14985663)
chr4 (4-48)||(16037912-16037956)
chr4 (4-48)||(19088459-19088503)
chr4 (4-48)||(24898477-24898521)
chr4 (4-48)||(46849787-46849831)
chr4 (4-48)||(53259256-53259300)
chr4 (10-45)||(30683651-30683686)
chr4 (1-48)||(43734401-43734448)
chr4 (4-46)||(37206545-37206587)
chr4 (4-46)||(38339782-38339824)
chr4 (4-45)||(1433389-1433430)
chr4 (4-48)||(6712251-6712295)
chr4 (4-48)||(15477763-15477807)
chr4 (46-78)||(23755676-23755708)
chr4 (4-48)||(33091571-33091615)
chr4 (4-48)||(39448606-39448650)
chr4 (4-48)||(41751934-41751978)
chr4 (4-48)||(42855457-42855501)
chr4 (10-46)||(43566502-43566538)
chr4 (4-48)||(44991397-44991441)
chr4 (4-44)||(50508575-50508615)
chr4 (4-44)||(53751020-53751060)
[»] chr2 (39 HSPs)
chr2 (4-78)||(26181958-26182032)
chr2 (4-78)||(34735601-34735675)
chr2 (4-78)||(2148144-2148218)
chr2 (4-78)||(8174143-8174217)
chr2 (4-78)||(10991969-10992043)
chr2 (4-78)||(13193106-13193180)
chr2 (4-78)||(16305143-16305217)
chr2 (4-78)||(24138764-24138838)
chr2 (4-78)||(7469284-7469358)
chr2 (4-78)||(12860625-12860699)
chr2 (4-78)||(15744575-15744649)
chr2 (4-78)||(19847576-19847650)
chr2 (4-78)||(29472360-29472434)
chr2 (4-69)||(36713706-36713771)
chr2 (1-78)||(41474197-41474274)
chr2 (10-78)||(19815962-19816030)
chr2 (4-78)||(17052175-17052250)
chr2 (4-78)||(7496237-7496311)
chr2 (4-78)||(15406014-15406088)
chr2 (4-78)||(24372225-24372299)
chr2 (4-78)||(38332822-38332896)
chr2 (4-61)||(33470198-33470255)
chr2 (4-48)||(2148004-2148048)
chr2 (4-48)||(10992139-10992183)
chr2 (4-48)||(15405874-15405918)
chr2 (1-44)||(7469458-7469501)
chr2 (10-48)||(13193276-13193314)
chr2 (10-48)||(36713873-36713911)
chr2 (4-45)||(41474373-41474414)
chr2 (4-48)||(7496098-7496142)
chr2 (4-48)||(8174003-8174047)
chr2 (10-48)||(34735467-34735505)
chr2 (4-46)||(42834540-42834582)
chr2 (4-45)||(19815822-19815863)
chr2 (4-45)||(29472533-29472574)
chr2 (4-48)||(12860498-12860542)
chr2 (4-48)||(16305313-16305357)
chr2 (4-48)||(17052342-17052386)
chr2 (4-48)||(24372085-24372129)
[»] chr1 (50 HSPs)
chr1 (4-78)||(45052947-45053021)
chr1 (4-78)||(1762932-1763006)
chr1 (4-78)||(2064469-2064543)
chr1 (4-78)||(9006449-9006523)
chr1 (4-78)||(38127827-38127901)
chr1 (4-78)||(49140401-49140475)
chr1 (4-77)||(27400683-27400756)
chr1 (4-78)||(12127311-12127385)
chr1 (4-78)||(12481317-12481391)
chr1 (4-78)||(23476599-23476673)
chr1 (4-78)||(37304146-37304220)
chr1 (4-78)||(37576299-37576373)
chr1 (1-78)||(6798065-6798142)
chr1 (1-78)||(37284986-37285063)
chr1 (1-78)||(37585951-37586028)
chr1 (10-77)||(4330096-4330163)
chr1 (12-78)||(16024023-16024089)
chr1 (4-78)||(27547927-27548001)
chr1 (4-78)||(31703732-31703806)
chr1 (4-78)||(35612340-35612414)
chr1 (4-78)||(45843375-45843449)
chr1 (4-78)||(49643929-49644002)
chr1 (10-78)||(20306126-20306194)
chr1 (11-78)||(8762657-8762724)
chr1 (4-78)||(3089460-3089534)
chr1 (4-78)||(25995902-25995976)
chr1 (5-78)||(39486451-39486523)
chr1 (1-48)||(37304316-37304363)
chr1 (10-48)||(49140267-49140305)
chr1 (41-78)||(26707454-26707491)
chr1 (4-48)||(4697000-4697044)
chr1 (4-48)||(6797925-6797969)
chr1 (4-48)||(9006309-9006353)
chr1 (4-48)||(25996072-25996116)
chr1 (4-48)||(26707314-26707358)
chr1 (4-44)||(37585811-37585851)
chr1 (4-48)||(39486320-39486364)
chr1 (42-78)||(44322816-44322852)
chr1 (10-48)||(20306290-20306328)
chr1 (4-45)||(12127175-12127216)
chr1 (46-78)||(4697140-4697172)
chr1 (4-48)||(12481177-12481221)
chr1 (4-48)||(23476459-23476503)
chr1 (4-48)||(37576469-37576513)
chr1 (10-42)||(38000613-38000645)
chr1 (4-48)||(44322948-44322992)
chr1 (4-48)||(49643789-49643833)
chr1 (1-48)||(1762789-1762836)
chr1 (1-48)||(8760387-8760434)
chr1 (10-45)||(35612206-35612241)
[»] chr6 (44 HSPs)
chr6 (1-78)||(18053071-18053148)
chr6 (4-78)||(3423428-3423502)
chr6 (4-78)||(5938071-5938145)
chr6 (4-78)||(7270747-7270821)
chr6 (4-78)||(24744446-24744520)
chr6 (4-78)||(26600475-26600549)
chr6 (4-78)||(34890762-34890836)
chr6 (4-78)||(5310944-5311018)
chr6 (4-78)||(5639431-5639505)
chr6 (4-78)||(9046204-9046278)
chr6 (4-78)||(21540235-21540309)
chr6 (4-78)||(31247234-31247308)
chr6 (4-78)||(32993273-32993347)
chr6 (1-78)||(26957077-26957154)
chr6 (1-78)||(34994638-34994715)
chr6 (4-77)||(35167751-35167824)
chr6 (4-71)||(6532310-6532377)
chr6 (4-78)||(6137636-6137709)
chr6 (4-78)||(21856813-21856887)
chr6 (4-78)||(25176915-25176989)
chr6 (4-78)||(31237864-31237938)
chr6 (10-78)||(7270077-7270145)
chr6 (4-78)||(2517120-2517194)
chr6 (4-71)||(32753295-32753362)
chr6 (4-74)||(6236183-6236253)
chr6 (1-48)||(5311114-5311161)
chr6 (4-48)||(7270241-7270285)
chr6 (4-48)||(31238034-31238078)
chr6 (4-48)||(31247404-31247448)
chr6 (4-48)||(978533-978577)
chr6 (4-48)||(5937931-5937975)
chr6 (4-48)||(6236039-6236083)
chr6 (4-48)||(21856673-21856717)
chr6 (4-48)||(26600635-26600679)
chr6 (4-48)||(32753461-32753505)
chr6 (4-48)||(34994498-34994542)
chr6 (4-48)||(35167608-35167652)
chr6 (10-48)||(3423294-3423332)
chr6 (10-48)||(5639297-5639335)
chr6 (10-48)||(24744609-24744647)
chr6 (4-48)||(9046374-9046418)
chr6 (4-48)||(15932844-15932888)
chr6 (4-48)||(34890932-34890976)
chr6 (6-41)||(10412796-10412831)
[»] scaffold0220 (1 HSPs)
scaffold0220 (4-78)||(20869-20943)
[»] scaffold0032 (1 HSPs)
scaffold0032 (4-78)||(82116-82190)
[»] scaffold0019 (2 HSPs)
scaffold0019 (4-78)||(50734-50808)
scaffold0019 (4-48)||(50594-50638)
[»] scaffold0003 (4 HSPs)
scaffold0003 (4-78)||(349191-349265)
scaffold0003 (4-48)||(349361-349405)
scaffold0003 (39-78)||(113519-113558)
scaffold0003 (4-48)||(113654-113698)
[»] chr5 (23 HSPs)
chr5 (4-78)||(9989441-9989515)
chr5 (1-78)||(2183058-2183135)
chr5 (10-78)||(34264606-34264674)
chr5 (4-76)||(35570040-35570112)
chr5 (4-78)||(11316076-11316150)
chr5 (4-74)||(24040349-24040419)
chr5 (4-78)||(36440458-36440532)
chr5 (4-77)||(25567247-25567320)
chr5 (4-78)||(37424520-37424597)
chr5 (4-78)||(32288335-32288408)
chr5 (4-78)||(38958982-38959055)
chr5 (10-78)||(27185997-27186065)
chr5 (4-48)||(9989611-9989655)
chr5 (4-48)||(36440318-36440362)
chr5 (4-55)||(39325636-39325687)
chr5 (10-48)||(24040209-24040247)
chr5 (4-45)||(16860421-16860462)
chr5 (4-48)||(25182941-25182985)
chr5 (4-48)||(37424380-37424424)
chr5 (4-45)||(35569893-35569934)
chr5 (6-46)||(11316244-11316284)
chr5 (4-48)||(27186161-27186205)
chr5 (4-47)||(39325530-39325573)
[»] scaffold0340 (2 HSPs)
scaffold0340 (4-78)||(18391-18465)
scaffold0340 (4-48)||(18561-18605)
[»] scaffold0221 (2 HSPs)
scaffold0221 (4-78)||(8546-8620)
scaffold0221 (4-48)||(8716-8760)
[»] scaffold0182 (2 HSPs)
scaffold0182 (4-78)||(19826-19900)
scaffold0182 (4-48)||(19996-20040)
[»] scaffold0134 (2 HSPs)
scaffold0134 (4-78)||(14393-14467)
scaffold0134 (4-48)||(14253-14297)
[»] scaffold0029 (1 HSPs)
scaffold0029 (4-78)||(72880-72954)
[»] scaffold0037 (3 HSPs)
scaffold0037 (4-78)||(45874-45948)
scaffold0037 (4-48)||(56424-56468)
scaffold0037 (4-48)||(63549-63593)
[»] scaffold0072 (2 HSPs)
scaffold0072 (14-77)||(15576-15639)
scaffold0072 (4-48)||(15736-15780)
[»] scaffold0186 (2 HSPs)
scaffold0186 (4-78)||(24280-24354)
scaffold0186 (4-42)||(24456-24494)
[»] scaffold0115 (1 HSPs)
scaffold0115 (4-78)||(21630-21703)
[»] scaffold0246 (2 HSPs)
scaffold0246 (4-67)||(6116-6179)
scaffold0246 (4-48)||(6283-6327)
[»] scaffold0260 (1 HSPs)
scaffold0260 (4-45)||(14309-14350)


Alignment Details
Target: chr3 (Bit Score: 66; Significance: 7e-30; HSPs: 61)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 32633400 - 32633323
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
32633400 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 32633323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 22151963 - 22152037
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||    
22151963 tgttaattttattcaaataaacgatagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 22152037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 44893858 - 44893932
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
44893858 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 44893932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 8474178 - 8474104
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
8474178 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8474104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 10506280 - 10506206
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
10506280 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 10506206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21969747 - 21969821
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||    
21969747 tgttacttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcgttttg 21969821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21992183 - 21992257
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||    
21992183 tgttacttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcgttttg 21992257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 26318514 - 26318440
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
26318514 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26318440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 39241476 - 39241550
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
39241476 tgttagttttattcaaataaacgttaatgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 39241550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 42591902 - 42591976
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
42591902 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 42591976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 47669377 - 47669451
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
47669377 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 47669451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 54108234 - 54108160
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
54108234 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 54108160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 54752281 - 54752355
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||    
54752281 tgttagttttattcaaataaacattatggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 54752355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 39951472 - 39951549
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||||||||||    
39951472 ttatgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctttaactttatttattagtatcattttg 39951549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 12203877 - 12203809
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||    
12203877 ttttattcaaataaacgttagagtttgtgttatgtgggacctctaactttatttattagtatcattttg 12203809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1994500 - 1994426
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
1994500 tgttatttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 1994426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 4757825 - 4757751
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
4757825 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 4757751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5900755 - 5900681
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
5900755 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 5900681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15986353 - 15986427
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||||||||||||||    
15986353 tgttagttttattcaaataaatgttagagtttgtgttatgtgggttctctaactttatttattagtatcattttg 15986427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 39664516 - 39664442
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
39664516 tgttagttttattcaaataaatgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 39664442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 11256227 - 11256295
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||| ||||||||| ||||||||||||||| ||||||||||||||||    
11256227 ttttattcaaataaacgttagagtttctgttatgtgtgtcctctaactttatttattagtatcattttg 11256295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 11 - 78
Target Start/End: Original strand, 22201741 - 22201808
Alignment:
11 tttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
22201741 tttattcaaataaacgttaaggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 22201808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 16931724 - 16931798
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||| |||||| ||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
16931724 tgttagttttatacaaatatacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 16931798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 27801607 - 27801681
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| |||||||||| |||||||||||||| ||||| ||||||||||    
27801607 tgttagttttattcaaataaacgttagagtttctgttatgtggatcctctaactttatttattaatatcattttg 27801681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 29818295 - 29818369
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| ||| |||||||||||||| ||||||||||||||||    
29818295 tgttagttttattcaaataaacgttagggtttgtgttatatggatcctctaactttatttattagtatcattttg 29818369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 51509451 - 51509377
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
51509451 tgttagttttattcaaataaatgttagggtttgtattatgtgggtcctctaactttatttattagtatcattttg 51509377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 18464571 - 18464648
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  ||||||||||||| |||||| || |||||| ||||||||||||||||    
18464571 ttatgttagttttattcaaataaacgttagggtttgtgttatgtaggtcctatagctttatttattagtatcattttg 18464648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 28986468 - 28986400
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||  ||||||||||| || ||||||||||||||| ||||||||||||||||    
28986468 ttttattcaaataaacgttagggtttgtgttatatgagtcctctaactttatttattagtatcattttg 28986400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 53716412 - 53716485
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||| ||||| ||||||||||||| ||||||||||||||||    
53716412 tgttagttttattcaaataaacgttagggtttgtgttacgtggg-cctctaactttatttattagtatcattttg 53716485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 47303348 - 47303277
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||  |||||||||||||||||||||| ||||| ||||||||||    
47303348 tgttagttttattcaaataaacgttagagtttgt--tatgtgggtcctctaactttatttatta-tatcattttg 47303277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 4773361 - 4773434
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||| ||||||||||||||||||||||||| ||||||||||||||||    
4773361 tgttagttttattcaaataaa-gttaggttttttgttatgtgggtcctctaactttatttattagtatcattttg 4773434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21568864 - 21568937
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||||||||||| ||||||||||| |||| ||||||||||||||||    
21568864 tgttagttttattcaaataaatgttagggtttgtgttatgt-ggtcctctaaccttatttattagtatcattttg 21568937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 24428691 - 24428759
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||    |||||||||||||| ||||||||||| || ||||||||||||||||    
24428691 ttttattcaaataaacgttgggatttgtgttatgtggatcctctaacttaatttattagtatcattttg 24428759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 41835252 - 41835184
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||||||||  ||||||||||  |||||| ||||||||||| ||||||||||||||||    
41835252 ttttatttaaataaacgttagtgtttgtgttacatgggtcatctaactttatttattagtatcattttg 41835184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 46152733 - 46152805
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||  | ||||||||||| ||||||||||||||||    
46152733 tgttagttttattcaaataaacgttagggtttgtgttatctgg--catctaactttatttattagtatcattttg 46152805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12203669 - 12203713
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||||||||  |||||||||||||||||    
12203669 tgttaattttattcaaataaacgttagggtttgtgttatgtgggt 12203713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 19883363 - 19883431
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||||||||  |||||||||||||| || |  ||||||||| ||||||||||||||||    
19883363 ttttatttaaataaacgttagggtttgtgttatgtgagtaccttaactttatttattagtatcattttg 19883431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 54108020 - 54108064
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
54108020 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 54108064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 54752495 - 54752451
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
54752495 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 54752451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24428902 - 24428855
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
24428902 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 24428855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 19883570 - 19883528
Alignment:
6 ttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||||||  |||||||||||||||||    
19883570 ttaattttattcaaataaacgttagggtttgtgttatgtgggt 19883528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 44894075 - 44894030
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||| |||||||||||||||| ||| ||||||||||||||||    
44894075 ttatgttagttttattcaaataaacattagagtttgtgttatgtgg 44894030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 4757612 - 4757656
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
4757612 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 4757656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 27801821 - 27801777
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
27801821 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 27801777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 28986278 - 28986322
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||    
28986278 tgttagttttattcaaataaacgttagagtttgtattatgtgggt 28986322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 39241690 - 39241646
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | ||||||||||||||||    
39241690 tgttagttttattcaaataaacgttagaatttgtgttatgtgggt 39241646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39664302 - 39664346
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
39664302 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 39664346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 47669591 - 47669548
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||    
47669591 tgttagttttattcaaataaacgttagggtttgtgttatgtggg 47669548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 51509234 - 51509281
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||   ||||||||||||||||    
51509234 ttatgttagttttattcaaataaacgttaggatttgtgttatgtgggt 51509281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 53716628 - 53716581
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||| |||||||  |||||||||||||||||    
53716628 ttatgttagttttattcaaattaacgttagggtttgtgttatgtgggt 53716581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 8473964 - 8474005
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
8473964 tgttagttttattcaaataaacgttatgatttgtgttatgtg 8474005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 26318300 - 26318341
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
26318300 tgttagttttattcaaataaacgttatgatttgtgttatgtg 26318341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21569077 - 21569033
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
21569077 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 21569033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21969961 - 21969917
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
21969961 tgttagttttatttaaataaacgttagggtttgtgttatgtgggt 21969917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21992397 - 21992353
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
21992397 tgttagttttatttaaataaacgttagggtttgtgttatgtgggt 21992353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 22152177 - 22152133
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
22152177 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 22152133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 29818509 - 29818465
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  | |||||||||||||||    
29818509 tgttagttttattcaaataaacgttagggattgtgttatgtgggt 29818465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 46152948 - 46152904
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    |||||||| |||||||||||||||||||   ||||||||||||||    
46152948 ttatgttagttttattcaaataaacgttgaggtttgtgttatgtg 46152904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 47303137 - 47303181
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
47303137 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 47303181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4773577 - 4773530
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||| |  ||||||| |||||||||    
4773577 ttatgttagttttattcaaataaacgtcaaggtttgtgctatgtgggt 4773530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 39
Target Start/End: Complemental strand, 12791508 - 12791473
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgt 39  Q
    ||||| |||||||||||||||||||| |||||||||    
12791508 tgttagttttattcaaataaacgttagagtttgtgt 12791473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7949530 - 7949604
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
7949530 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7949604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38588705 - 38588779
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
38588705 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 38588779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 7535168 - 7535091
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||    
7535168 ttatgttagttttattcaaataaacgttatagtttgtgttatgtgagtcctctagctttatttattagtatcattttg 7535091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 45077529 - 45077461
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
45077529 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 45077461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5435232 - 5435158
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||    
5435232 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcatctaactttatttattagtatcattttg 5435158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15871953 - 15871879
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||    
15871953 tgttagttttattcaaataaacgttagagcttgtgttatgtgggtcctctaactttatttattagtatcattttg 15871879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 18298561 - 18298488
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||    
18298561 tgttagttttattcaaataaacgttagagtttgtgttatgtgagtcctctaactttatttattagtatcatttt 18298488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5152866 - 5152792
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| || |||||||||||||    
5152866 tgttagttttattcaaataaacgttagagtttgtgttatatgggtcctctaactttatttactagtatcattttg 5152792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15048517 - 15048591
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
15048517 tgttagttttattcaaataaacgttagggtttttgttatgtgggtcctctaactttatttattagtatcattttg 15048591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 27473403 - 27473329
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||| |||||||||||||||| ||||||||||||||||    
27473403 tgttagttttattcaaataaacgttagggtttgtgttatgtaggtcctctaactttatttattagtatcattttg 27473329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 33296016 - 33295942
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
33296016 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 33295942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45276928 - 45276854
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  | |||||||||||||||||||||||||||| ||||||||||||||||    
45276928 tgttagttttattcaaataaacgttagggattgtgttatgtgggtcctctaactttatttattagtatcattttg 45276854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 1432249 - 1432323
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||||||||||||||| ||||| ||||||||||    
1432249 tgttagttttattcaaataaacgttagggtttgtgttatttgggtcctctaactttatttattaatatcattttg 1432323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 27669534 - 27669608
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||| ||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
27669534 tgttagttttattgaaataaacgttagggtttatgttatgtgggtcctctaactttatttattagtatcattttg 27669608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 44594932 - 44594859
Alignment:
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||| ||||||    
44594932 gttagttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtattattttg 44594859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 11173969 - 11173894
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattt 76  Q
    |||||||| ||||||||||||||| |||| |||||   ||||||||||||||||||||||| ||||||||||||||    
11173969 ttatgttagttttattcaaataaatgttagagtttagattatgtgggtcctctaactttatttattagtatcattt 11173894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 37569646 - 37569573
Alignment:
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| |||||||||||||||||||| ||||| || || |||||| |||||||||||| ||||||||||||||||    
37569646 gttagttttattcaaataaacgttagagtttatgctacgtgggttctctaactttatttattagtatcattttg 37569573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 40048177 - 40048247
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||    ||||||||||||||| ||||||||||||||||    
40048177 tgttagttttattcaaataaacgttaaagtttgtgttat----gtcctctaactttatttattagtatcattttg 40048247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1646838 - 1646765
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||| ||||||||||||||||||||||||| ||||||||||||||||    
1646838 tgttagttttattcaaataaa-gttaggttttatgttatgtgggtcctctaactttatttattagtatcattttg 1646765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1651903 - 1651830
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| | ||||||||||||||    
1651903 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttgttagtatcattttg 1651830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1740279 - 1740206
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| | ||||||||||||||    
1740279 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttgttagtatcattttg 1740206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 1870051 - 1870125
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||   ||||||||| |||||||||| ||||||||||||||||    
1870051 tgttagttttattcaaataaacgttagggtttgtgaattgtgggtcccctaactttatttattagtatcattttg 1870125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45077317 - 45077364
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||    
45077317 ttatgttagttttattcaaataaacgttatggtttgtgttatgtgggt 45077364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 15871736 - 15871783
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
15871736 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 15871783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38588922 - 38588875
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||||||  |||||| ||||||||||    
38588922 ttatgttaattttattcaaataaacgttagggtttgtattatgtgggt 38588875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 33819909 - 33819947
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
33819909 ttttattcaaataaacgttagagtttgtgttatgtgggt 33819947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5152652 - 5152696
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5152652 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5152696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5435018 - 5435062
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5435018 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5435062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 34470876 - 34470832
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
34470876 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggt 34470832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 40048386 - 40048342
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
40048386 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggt 40048342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 1870267 - 1870224
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||    
1870267 tgttagttttattcaaataaacgttagggtttgtgttatgtggg 1870224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 11708067 - 11708008
Alignment:
19 aataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||  | || | ||||||||||| ||||||||||| ||||||||||||||||    
11708067 aataaacgttagggcttatattatgtgggtcatctaactttatttattagtatcattttg 11708008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 15048731 - 15048690
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
15048731 tgttagttttattcaaataaacgttatgatttgtgttatgtg 15048690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7534951 - 7534995
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
7534951 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 7534995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 27473189 - 27473233
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| ||||  ||||||||||||||||    
27473189 tgttagttttattcaaataaacattatgatttgtgttatgtgggt 27473233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 37569432 - 37569476
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||| |||||||||||| |||| ||||||||||||    
37569432 tgttagttttattcgaataaacgttatggtttttgttatgtgggt 37569476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 40660107 - 40660143
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||||||||||||||||||  |||||||||||||||    
40660107 ttttattcaaataaacgttagggtttgtgttatgtgg 40660143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 43
Target Start/End: Complemental strand, 40660218 - 40660179
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatg 43  Q
    ||||| |||||||||||||||||||| ||||||| |||||    
40660218 tgttagttttattcaaataaacgttagagtttgtattatg 40660179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45276712 - 45276759
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||| ||| ||||||||||||||| ||||  |||||||||||||||||    
45276712 ttatattagttttattcaaataaatgttagggtttgtgttatgtgggt 45276759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 10526429 - 10526503
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
10526429 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 10526503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 28286452 - 28286375
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
28286452 ttatattagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 28286375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 28297937 - 28298011
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
28297937 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 28298011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 33716706 - 33716780
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||    
33716706 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagtatcattttg 33716780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41192017 - 41191943
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
41192017 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 41191943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 44332851 - 44332777
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
44332851 tgttagttttattcaaataaacgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 44332777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 40673340 - 40673271
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagta 70  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
40673340 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagta 40673271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 56; E-Value: 7e-24
Query Start/End: Original strand, 4 - 75
Target Start/End: Original strand, 1114172 - 1114243
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatt 75  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||    
1114172 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagcatcatt 1114243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 6356883 - 6356957
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
6356883 tgttagttttattcaaataaatgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 6356957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 17359299 - 17359373
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||||||    
17359299 tgttagttttattcaaataaacattagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 17359373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 34037243 - 34037169
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| ||||||||||    
34037243 tgttagttttattcaaataaacgttagagtttatgttatgtgggtcctctaactttatttattaatatcattttg 34037169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 36423487 - 36423561
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
36423487 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 36423561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 48626395 - 48626321
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
48626395 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 48626321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 7579195 - 7579130
Alignment:
13 tattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||    
7579195 tattcaaataaacgttatggtttttgttatgtgggtcctctaactttatttattagtatcattttg 7579130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 19681821 - 19681753
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
19681821 ttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 19681753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 31638269 - 31638201
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| |||||||| |||||| |||||||||||||| ||||||||||||||||    
31638269 ttttattcaaataaacgttatggtttgtgtcatgtggatcctctaactttatttattagtatcattttg 31638201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 8937181 - 8937111
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| ||||||    
8937181 tgttagttttattcaaataaacgttatggtttgtgttatgtgggttctctaactttatttattaatatcat 8937111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41453337 - 41453263
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
41453337 tgttagttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 41453263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 4 - 61
Target Start/End: Original strand, 7909404 - 7909461
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttat 61  Q
    ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7909404 tgttagttttattcaaataaacgttatagtttgtgttatgtggatcctctaactttat 7909461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 6356404 - 6356477
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||||||||||||    
6356404 tgttagttttattcaaataaa-gttagattttgtgttatatgggtcctctaactttatttattagtatcattttg 6356477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8542617 - 8542691
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||| | |||||||||| |||||||| ||||||||||| |||||| |||||||||    
8542617 tgttagttttattcaaataaacgtcagagtttgtgttgtgtgggtcttctaactttatttattagcatcattttg 8542691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21391522 - 21391448
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||||||||||||| || ||||||||||| ||||||||||||||||    
21391522 tgttagttttattcaaataaatgttagtgtttgtgttatgtggatcatctaactttatttattagtatcattttg 21391448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 66
Target Start/End: Complemental strand, 27738997 - 27738935
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtatt 66  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||    
27738997 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttatt 27738935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 41751768 - 41751842
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||| || ||||||||||| ||||||||| ||||||    
41751768 tgttagttttattcaaataaacgttagggtttgtgttatgtggatcttctaactttatttattagtattattttg 41751842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 43247540 - 43247607
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| |||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
43247540 ttttattcaaataaacattag-gtttatgttatgtgggtcctctaactttatttattagtatcattttg 43247607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 28298151 - 28298107
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||| ||||||||||||||||||    
28298151 tgttaattttattcaaataaacgttagagtttgtgttatgtgggt 28298107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 21391308 - 21391350
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
21391308 tgttaattttattcaaataaacgttagagtttgtgttatgtgg 21391350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 36423701 - 36423657
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
36423701 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36423657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 17750050 - 17750097
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||| ||||||||||| |||||    
17750050 ttatgttagttttattcaaataaacgttatggtttgtgttatatgggt 17750097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7578990 - 7579034
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
7578990 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 7579034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 28286235 - 28286279
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
28286235 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 28286279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 35146817 - 35146861
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
35146817 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 35146861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 41191800 - 41191844
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
41191800 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 41191844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33716919 - 33716872
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||| |||||||||||||||  ||| |||||||||||||    
33716919 ttatgttaattttgttcaaataaacgttagggttggtgttatgtgggt 33716872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 4931605 - 4931556
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctct 53  Q
    ||||| |||||||||||||||||||| | ||||||||||||  |||||||    
4931605 tgttagttttattcaaataaacgttagaatttgtgttatgtaagtcctct 4931556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 48626181 - 48626222
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
48626181 tgttagttttattcaaataaacgttatgatttgtgttatgtg 48626222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 1114377 - 1114333
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
1114377 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 1114333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 8936967 - 8937011
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
8936967 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 8937011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 10526642 - 10526598
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
10526642 tgttagttttattcaaataaacgttaagttttgtgttatgtgggt 10526598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 63; Significance: 4e-28; HSPs: 62)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21763513 - 21763439
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
21763513 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 21763439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 1433597 - 1433529
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
1433597 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 1433529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19088673 - 19088599
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
19088673 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 19088599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19508745 - 19508671
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||    
19508745 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatgattttg 19508671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24898307 - 24898381
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
24898307 tgttagttttattcaaataaacgttagagtttgtgttatgtgcgtcctctaactttatttattagtatcattttg 24898381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 30683860 - 30683786
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
30683860 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 30683786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 33091785 - 33091711
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
33091785 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 33091711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 42855671 - 42855597
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
42855671 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 42855597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 46850001 - 46849927
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
46850001 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 46849927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 6712078 - 6712155
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
6712078 ttatgttagttttattcaaataaacgttagggtttctgttatgtgggtcctctaactttatttattagtatcattttg 6712155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 38339611 - 38339684
Alignment:
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
38339611 gttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 38339684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 44957504 - 44957581
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||||||||||    
44957504 ttatgttagttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtatcattttg 44957581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8592087 - 8592161
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
8592087 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 8592161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 14985449 - 14985523
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||| |||||||||||||||||||||||||| ||||||||||||||||    
14985449 tgttagttttattcaaataaacgttagggttcgtgttatgtgggtcctctaactttatttattagtatcattttg 14985523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15477977 - 15477903
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||||||||    
15477977 tgttagttttattcaaataaacgttagagtttgtgttacgtgggtcctctaactttgtttattagtatcattttg 15477903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 16038126 - 16038052
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
16038126 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 16038052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 37206759 - 37206685
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
37206759 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 37206685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 39448820 - 39448746
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||| |||||||||    
39448820 tgttagttttattcaaataaacgttagagtttgtgttatctgggtcctctaactttatttattagcatcattttg 39448746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 43734618 - 43734544
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
43734618 tgttagttttattcaaataaacgttaagatttgtgttatgtgggtcctctaactttatttattagtatcattttg 43734544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 44991610 - 44991536
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
44991610 tgttagttttgttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 44991536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 50508789 - 50508715
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||||||    
50508789 tgttagttttattcaaataaacgttatggtttatgttatgtgggtcctctaactttatttattagtattattttg 50508715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 52557419 - 52557345
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| |||||||| |||||||||||||| ||||||||||||||||    
52557419 tgttagttttattcaaataaacgttagagtttgtattatgtggatcctctaactttatttattagtatcattttg 52557345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 53259470 - 53259396
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
53259470 tgttagttttattcaaatacacgttagagtttgtgttatgtgagtcctctaactttatttattagtatcattttg 53259396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 53751234 - 53751160
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||| ||||||    
53751234 tgttagttttattcaaataaacgttatgatttgtgttatgtgggtcctctaactttatttattagtataattttg 53751160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 12817930 - 12817998
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||| ||||||||||||    
12817930 ttttattcaaataaacgttagagtttgtgttatgtgggtcctgtaactttatttatcagtatcattttg 12817998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 50768945 - 50769013
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||||||||||    
50768945 ttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtatcattttg 50769013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 624011 - 623937
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| |||||||||||||||| |||||||||||||| |||||| |||||||||    
624011 tgttagttttattcaaataaatgttagagtttgtgttatgtggatcctctaactttatttattagcatcattttg 623937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 25182144 - 25182070
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||  |||||||||    
25182144 tgttagttttattcaaataaacgtttgagtttgtgttatgtgggtcctctaactttatttattaacatcattttg 25182070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41752148 - 41752074
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||| ||||| ||||| ||||||||||    
41752148 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaattttatttattaatatcattttg 41752074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 53995268 - 53995192
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||| ||||||||||    
53995268 ttatgttagttttattcaaataa-cgttagggtttgtgttatgtgggtcctctaactttatttattaatatcattttg 53995192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 36122759 - 36122691
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| |||||||||||| | |||||||||||| ||| ||||||||||||||||    
36122759 ttttattcaaataaacgttagagtttgtgttatataggtcctctaactatatttattagtatcattttg 36122691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 23756132 - 23756058
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||| ||||||||| |||||||||||||| ||||||||||||||||    
23756132 tgttagttttattcaaataaatgttagggtttgcgttatgtggatcctctaactttatttattagtatcattttg 23756058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 43566710 - 43566636
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||| ||||||||||||   |||||||||||||||||||| |||||||| ||||||||||||||||    
43566710 tgttagttttatttaaataaacgttaggatttgtgttatgtgggtcctcaaactttatttattagtatcattttg 43566636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 41878185 - 41878117
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||| |||||||||||||||| |||||||| ||||||||||||||||    
41878185 ttttattcaaataaatgttagggtttatgttatgtgggtcctccaactttatttattagtatcattttg 41878117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36122548 - 36122595
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||    
36122548 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36122595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 52557205 - 52557249
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
52557205 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 52557249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 21763305 - 21763343
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
21763305 ttttattcaaataaacgttagagtttgtgttatgtgggt 21763343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 53995058 - 53995096
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
53995058 ttttattcaaataaacgttagagtttgtgttatgtgggt 53995096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 12818138 - 12818093
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtc 49  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||    
12818138 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtc 12818093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 23755533 - 23755578
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||| |||||||||||||||||||| ||||||||||| ||||    
23755533 ttatgttagttttattcaaataaacgttaaagtttgtgttacgtgg 23755578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 14985663 - 14985619
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
14985663 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 14985619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 16037912 - 16037956
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
16037912 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 16037956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 19088459 - 19088503
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
19088459 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 19088503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 24898521 - 24898477
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
24898521 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 24898477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 46849787 - 46849831
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
46849787 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 46849831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 53259256 - 53259300
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
53259256 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 53259300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 30683651 - 30683686
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtg 45  Q
    |||||||||||||||||||| |||||||||||||||    
30683651 ttttattcaaataaacgttagagtttgtgttatgtg 30683686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43734401 - 43734448
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||   ||||||||||||||||    
43734401 ttatgttagttttattcaaataaacgttaggatttgtgttatgtgggt 43734448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 37206545 - 37206587
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
37206545 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 37206587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Complemental strand, 38339824 - 38339782
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
38339824 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 38339782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 1433389 - 1433430
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
1433389 tgttagttttattcaaataaacgttagggtttgtgttatgtg 1433430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 6712295 - 6712251
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
6712295 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 6712251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 15477763 - 15477807
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
15477763 tgttagttttattaaaataaacgttagtgtttgtgttatgtgggt 15477807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 23755708 - 23755676
Alignment:
46 ggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| ||||||||||||||||    
23755708 ggtcctctaactttatttattagtatcattttg 23755676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 33091571 - 33091615
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
33091571 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 33091615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39448606 - 39448650
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| |||||| ||||| ||||||||||||||||||    
39448606 tgttagttttatttaaataagcgttagagtttgtgttatgtgggt 39448650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 41751934 - 41751978
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
41751934 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 41751978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 42855457 - 42855501
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
42855457 tgttagttttattcaaataaaggttagggtttgtgttatgtgggt 42855501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 43566502 - 43566538
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||||||||||||||||||  |||||||||||||||    
43566502 ttttattcaaataaacgttagggtttgtgttatgtgg 43566538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 44991397 - 44991441
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
44991397 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 44991441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 50508575 - 50508615
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| ||||||||||||||||||||  |||||||||||||    
50508575 tgttagttttattcaaataaacgttagggtttgtgttatgt 50508615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 53751020 - 53751060
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| ||||||||||||||||||||  |||||||||||||    
53751020 tgttagttttattcaaataaacgttagggtttgtgttatgt 53751060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 26182032 - 26181958
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
26182032 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26181958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 34735675 - 34735601
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
34735675 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 34735601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 2148218 - 2148144
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
2148218 tgttagttttattcaaataaacgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 2148144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 8174217 - 8174143
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
8174217 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8174143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 10991969 - 10992043
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
10991969 tgttagttttattcaaataaacgttacagtttgtgttatgtgggtcctctaactttatttattagcatcattttg 10992043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 13193106 - 13193180
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||    
13193106 tgttagttttattcaaataaacgttagagtttgtgttatgttggtcctctaactttatttattagtatcattttg 13193180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 16305143 - 16305217
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
16305143 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 16305217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 24138838 - 24138764
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
24138838 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 24138764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7469284 - 7469358
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| || |||||||||||||    
7469284 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttactagtatcattttg 7469358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12860699 - 12860625
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
12860699 tgttagttttattcaaataaacgttacggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 12860625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15744575 - 15744649
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
15744575 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 15744649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19847650 - 19847576
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
19847650 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 19847576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 29472360 - 29472434
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
29472360 tgttagttttattcaaataaacgttaaggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 29472434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 4 - 69
Target Start/End: Original strand, 36713706 - 36713771
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagt 69  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||    
36713706 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagt 36713771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 41474197 - 41474274
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||| ||||||||||||  |||||||||||||||||| ||||||||||| ||||||||||||||||    
41474197 ttatgttagttttatttaaataaacgttagtgtttgtgttatgtgggtcatctaactttatttattagtatcattttg 41474274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 19816030 - 19815962
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||    
19816030 ttttattcaaataaacgttagagtctgtgttatgtgggtcctctgactttatttattagtatcattttg 19815962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 17052175 - 17052250
Alignment:
4 tgttaattttattcaaataaa-cgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
17052175 tgttagttttattcaaataaaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 17052250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7496311 - 7496237
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||| |||||||||||| |||||| |||||||||    
7496311 tgttagttttattcaaataaacgttagggtttgtgttatgtgggttctctaactttatttattagcatcattttg 7496237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15406088 - 15406014
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||| ||||||    
15406088 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtattattttg 15406014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 24372299 - 24372225
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||   ||||||||||||||||||||||||||||| ||||||||||||||||    
24372299 tgttagttttattcaaataaacattaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 24372225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38332822 - 38332896
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
38332822 tgttagttttattcaaataaatgttagggtttgttttatgtgggtcctctaactttatttattagtatcattttg 38332896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 4 - 61
Target Start/End: Complemental strand, 33470255 - 33470198
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttat 61  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||||||||||||    
33470255 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttat 33470198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 2148004 - 2148048
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
2148004 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 2148048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 10992183 - 10992139
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
10992183 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 10992139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 15405874 - 15405918
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
15405874 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 15405918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7469501 - 7469458
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    |||||||| ||||||||||||||||||||| |||||||||||||    
7469501 ttatgttagttttattcaaataaacgttatggtttgtgttatgt 7469458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 13193314 - 13193276
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
13193314 ttttattcaaataaacgttagagtttgtgttatgtgggt 13193276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 36713911 - 36713873
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
36713911 ttttattcaaataaacgttagagtttgtgttatgtgggt 36713873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 41474414 - 41474373
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
41474414 tgttagttttattcaaataaacgttagagtttgtgttatgtg 41474373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7496098 - 7496142
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
7496098 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 7496142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 8174003 - 8174047
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||| |||||||  |||||||||||||||||    
8174003 tgttaattttattcaaatgaacgttagggtttgtgttatgtgggt 8174047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 34735467 - 34735505
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
34735467 ttttattcaaataaacgttagggtttgtgttatgtgggt 34735505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 42834540 - 42834582
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
42834540 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 42834582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 19815822 - 19815863
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
19815822 tgttagttttattcaaataaacgttatgatttgtgttatgtg 19815863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 29472574 - 29472533
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
29472574 tgttagttttattcaaataaacgttagggtttgtgttatgtg 29472533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12860498 - 12860542
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
12860498 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 12860542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 16305357 - 16305313
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||  ||||| |||||||||||||||||    
16305357 tgttagttttattcaaataagagttatggtttgtgttatgtgggt 16305313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 17052386 - 17052342
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||| ||||||||||||||||  |||||||||||||||||    
17052386 tgttagtttcattcaaataaacgttagtgtttgtgttatgtgggt 17052342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 24372085 - 24372129
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
24372085 tgttagttttattcaaataaacgttagggtttgtattatgtgggt 24372129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 4e-28; HSPs: 50)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45053021 - 45052947
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
45053021 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 45052947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1763006 - 1762932
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
1763006 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 1762932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 2064543 - 2064469
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
2064543 tgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 2064469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 9006523 - 9006449
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||    
9006523 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagtatcattttg 9006449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38127827 - 38127901
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||    
38127827 tgttagttttattcaaataaacgttatggtttgttttatgtgggtcctctaactttatttattagtatcattttg 38127901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 49140475 - 49140401
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
49140475 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 49140401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 27400756 - 27400683
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||||||||||||    
27400756 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcatttt 27400683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12127385 - 12127311
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
12127385 tgttagttttgttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 12127311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12481391 - 12481317
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
12481391 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 12481317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 23476673 - 23476599
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
23476673 tgttagttttattcaaataaacgttaatgtttgtgttatgtgagtcctctaactttatttattagtatcattttg 23476599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 37304146 - 37304220
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||| ||||||||||||||||| ||||||||||||||||    
37304146 tgttagttttattcaaataaacgttagggtttgtgttatgagggtcctctaactttatttattagtatcattttg 37304220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 37576299 - 37576373
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||| ||||||||||||    
37576299 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttataagtatcattttg 37576373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 6798142 - 6798065
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||| ||||||||||| ||||| ||||||||||||||||    
6798142 ttatgttagttttattcaaataaacgttagggtttgtgttatgagggtcctctaattttatttattagtatcattttg 6798065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 37285063 - 37284986
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||| ||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
37285063 ttatgttagttttatttaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 37284986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 37586028 - 37585951
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||| | ||||||||||||||||||||||| ||||||||| ||||||    
37586028 ttatgttagttttattcaaataaacgttagagtttatattatgtgggtcctctaactttatttattagtattattttg 37585951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 4330163 - 4330096
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||||||||||||||||||  |||||||||||||||||| ||||||||||| |||||||||||||||    
4330163 ttttattcaaataaacgttagggtttgtgttatgtgggtcttctaactttatttattagtatcatttt 4330096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 12 - 78
Target Start/End: Original strand, 16024023 - 16024089
Alignment:
12 ttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||  |||||||||||| ||||||||||||||||| ||||||||||||||||    
16024023 ttattcaaataaacgttagggtttgtgttatgagggtcctctaactttatttattagtatcattttg 16024089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 27548001 - 27547927
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||| || |||||||||||||||||||||| ||||||||||||||||    
27548001 tgttagttttattcaaataaacgttagggtttatggtatgtgggtcctctaactttatttattagtatcattttg 27547927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31703732 - 31703806
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   |||||||||||||||||||||||||||||| |||||| |||||||||    
31703732 tgttagttttattcaaataaacgttggggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 31703806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 35612414 - 35612340
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  || |||||||||| |||||||||||||||| ||||||||||||||||    
35612414 tgttagttttattcaaataaacgttagggtctgtgttatgttggtcctctaactttatttattagtatcattttg 35612340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45843449 - 45843375
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||||| |||| | ||||||||||||||||    
45843449 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctagctttttttattagtatcattttg 45843375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 49644002 - 49643929
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||| |||||||||||| ||||||||||||||||    
49644002 tgttagttttattcaaataaacgttag-gtttgtgttatgtgggttctctaactttatttattagtatcattttg 49643929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 20306126 - 20306194
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||   ||||||||||||| ||||||||||||||| ||||||||||||||||    
20306126 ttttattcaaataaacgttaggatttgtgttatgtgagtcctctaactttatttattagtatcattttg 20306194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 8762724 - 8762657
Alignment:
11 tttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||    |||||||||||||||||||||||||||| ||||||||||||||||    
8762724 tttattcaaataaacgttaagagttgtgttatgtgggtcctctaactttatttattagtatcattttg 8762657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 3089460 - 3089534
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||| ||||||||||||||||  ||||||||||||||| |||| ||||||||| ||||||||||||||||    
3089460 tgttagtttaattcaaataaacgttagggtttgtgttatgtggatcctataactttatttattagtatcattttg 3089534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 25995902 - 25995976
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||    |||||||||||||| |||||||||||||| ||||||||||||||||    
25995902 tgttagttttattcaaataaacgttgagatttgtgttatgtggatcctctaactttatttattagtatcattttg 25995976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 39486523 - 39486451
Alignment:
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||| ||||||||  ||||||||||| |||||||||||||||||| ||||||||||||||||    
39486523 gttagttttattcaaa-aaacgttagggtttgtgttatatgggtcctctaactttatttattagtatcattttg 39486451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37304363 - 37304316
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
37304363 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 37304316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 49140267 - 49140305
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
49140267 ttttattcaaataaacgttagagtttgtgttatgtgggt 49140305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 78
Target Start/End: Complemental strand, 26707491 - 26707454
Alignment:
41 atgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| ||||||||||||||||    
26707491 atgtgggtcctctaactttatttattagtatcattttg 26707454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 4697000 - 4697044
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||| |||||||||||||||| ||||||||||||||||||    
4697000 tgttagtttaattcaaataaacgttagagtttgtgttatgtgggt 4697044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 6797925 - 6797969
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||| ||||||||||||||| ||||||||||||||||||    
6797925 tgttagttttgttcaaataaacgttagagtttgtgttatgtgggt 6797969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 9006309 - 9006353
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
9006309 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 9006353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 25996116 - 25996072
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
25996116 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 25996072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 26707314 - 26707358
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||  ||||||||||||||||||    
26707314 tgttagttttattcaaataaacgttggagtttgtgttatgtgggt 26707358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 37585811 - 37585851
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| |||||||||||||||||||| ||||||||||||||    
37585811 tgttagttttattcaaataaacgttagagtttgtgttatgt 37585851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39486320 - 39486364
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| || ||||||||||||||||| ||||||||||||||||||    
39486320 tgttagttctattcaaataaacgttagagtttgtgttatgtgggt 39486364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 44322816 - 44322852
Alignment:
42 tgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||    
44322816 tgtgggtcctctaactttatttattagtatcattttg 44322852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 20306328 - 20306290
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
20306328 ttttattcaaataaacgttagggtttgtgttatgtgggt 20306290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 12127175 - 12127216
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
12127175 tgttagttttattcaaataaacgttatgatttgtgttatgtg 12127216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 4697172 - 4697140
Alignment:
46 ggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| ||||||||||||||||    
4697172 ggtcctctaactttatttattagtatcattttg 4697140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12481177 - 12481221
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
12481177 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 12481221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 23476459 - 23476503
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | | ||||||||||||||    
23476459 tgttagttttattcaaataaacgttagaatctgtgttatgtgggt 23476503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 37576513 - 37576469
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
37576513 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 37576469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 42
Target Start/End: Original strand, 38000613 - 38000645
Alignment:
10 ttttattcaaataaacgttatagtttgtgttat 42  Q
    |||||||||||||||||||| ||||||||||||    
38000613 ttttattcaaataaacgttagagtttgtgttat 38000645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 44322992 - 44322948
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
44322992 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 44322948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 49643789 - 49643833
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
49643789 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 49643833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1762789 - 1762836
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||| |||  |||||| ||||||||||    
1762789 ttatgttagttttattcaaataaacattagggtttgtattatgtgggt 1762836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8760387 - 8760434
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||  ||||||||||||||| |||  |||||||||||||||||    
8760387 ttatgttagctttattcaaataaacattagggtttgtgttatgtgggt 8760434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 35612206 - 35612241
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||||||||||||||||||  ||||||||||||||    
35612206 ttttattcaaataaacgttagggtttgtgttatgtg 35612241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 44)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 18053071 - 18053148
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
18053071 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 18053148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 3423502 - 3423428
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||    
3423502 tgttagttttattcaaataaacgttagagtttgtgatatgtgggtcctctaactttatttattagtatcattttg 3423428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5938145 - 5938071
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
5938145 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 5938071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7270747 - 7270821
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
7270747 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7270821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24744446 - 24744520
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
24744446 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 24744520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 26600475 - 26600549
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
26600475 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26600549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 34890762 - 34890836
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
34890762 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 34890836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 5310944 - 5311018
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
5310944 tgttagttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 5311018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5639505 - 5639431
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||| ||||||||||||||||| |||||||||||| ||||||||||||||||    
5639505 tgttagttttattcaaataaacattatggtttgtgttatgtgggttctctaactttatttattagtatcattttg 5639431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 9046204 - 9046278
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||||||||||| ||||| ||||||||||||||||    
9046204 tgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctctaaatttatttattagtatcattttg 9046278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21540309 - 21540235
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||| |||||||||||||||||||||||| ||||||||||||||||    
21540309 tgttagttttattcaaataaacgttagggtttgcgttatgtgggtcctctaactttatttattagtatcattttg 21540235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31247234 - 31247308
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||| ||||||||||||||| ||||||||||||||||    
31247234 tgttagttttattcaaataaacgttagagtttgttttatgtgagtcctctaactttatttattagtatcattttg 31247308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 32993347 - 32993273
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
32993347 tgttagttttattcaaataaacgttagggtttgtattatgtgggtcctctaactttatttattagtatcattttg 32993273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 26957077 - 26957154
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||| ||||||| |||||||||| |||||| ||||||||||||||||    
26957077 ttatgttagttttattcaaataaacgttaaagtttatgttatgggggtcctctagctttatttattagtatcattttg 26957154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 34994715 - 34994638
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||| |||||||||||||| || ||||||||||||||||    
34994715 ttatgttagttttattcaaataaacgttagggtttgtgttatgcgggtcctctaacttgatttattagtatcattttg 34994638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 35167824 - 35167751
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||| |||||||||  |||||||||||||||||||||||||||||| |||||||||||||||    
35167824 tgttagttttattcaagtaaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcatttt 35167751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 6532310 - 6532377
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtat 71  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||||||    
6532310 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtat 6532377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 6137709 - 6137636
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||||||||||||    
6137709 tgttagttttattcaaataaa-gttagattttgtgttatgtgggtcctctaactttatttattagtatcattttg 6137636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21856887 - 21856813
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||| |||||| |||||||||||||||||| |||||| |||||||||    
21856887 tgttagttttattcaaataaacgttatggtttttgttatatgggtcctctaactttatttattagcatcattttg 21856813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 25176989 - 25176915
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||| ||||||||||||| |||||| |||||||||    
25176989 tgttagttttattcaaataaacgttagggtttgtgttatgtggggcctctaactttatttattagcatcattttg 25176915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31237864 - 31237938
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||    
31237864 tgttagttttattcaaataaatgttagagtttgttttatgtgggtcctctaactttatttattagtattattttg 31237938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 7270077 - 7270145
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
7270077 ttttatttaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7270145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 2517120 - 2517194
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||| |||||||| ||| || |||||||||    
2517120 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctccaactttatttataagaatcattttg 2517194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 32753295 - 32753362
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtat 71  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||| ||| |||||||||    
32753295 tgttagttttattcaaataaatgttaaggtttgtgttatgtgggtcctctaactgtatttattagtat 32753362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 6236253 - 6236183
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||  ||||||||||||||  ||||||||||| || ||||||||||||    
6236253 tgttagttttattcaaataaacgttagggtttgtgttatgtgaatcctctaacttcatttattagtatcat 6236183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5311161 - 5311114
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||    
5311161 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggt 5311114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 7270285 - 7270241
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||| |||||||| |||||||||    
7270285 tgttaattttattcaaataaacgttagagtttgtggtatgtgggt 7270241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 31238078 - 31238034
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
31238078 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 31238034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 31247448 - 31247404
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
31247448 tgttagttttattcaaataaacgttaaagtttgtgttatgtgggt 31247404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 978533 - 978577
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
978533 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 978577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5937931 - 5937975
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5937931 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5937975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 6236039 - 6236083
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
6236039 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 6236083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 21856673 - 21856717
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
21856673 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 21856717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 26600679 - 26600635
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
26600679 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 26600635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 32753505 - 32753461
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||| | ||||||||||||||||||    
32753505 tgttagttttattcaaataaacgtcagagtttgtgttatgtgggt 32753461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 34994498 - 34994542
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | ||||||||||||||||    
34994498 tgttagttttattcaaataaacgttagaatttgtgttatgtgggt 34994542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 35167608 - 35167652
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
35167608 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 35167652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 3423294 - 3423332
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
3423294 ttttattcaaataaacgttagggtttgtgttatgtgggt 3423332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 5639297 - 5639335
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||| |||| ||||||||||||||||||    
5639297 ttttattcaaataaatgttagagtttgtgttatgtgggt 5639335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 24744647 - 24744609
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
24744647 ttttattcaaataaacgttagggtttgtgttatgtgggt 24744609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 9046418 - 9046374
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| || |||||||||||||||||  |||||||||||||||||    
9046418 tgttagttctattcaaataaacgttagggtttgtgttatgtgggt 9046374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 15932888 - 15932844
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
15932888 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 15932844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 34890976 - 34890932
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
34890976 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 34890932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 10412831 - 10412796
Alignment:
6 ttaattttattcaaataaacgttatagtttgtgtta 41  Q
    ||||||||||||||||||||||||  ||||||||||    
10412831 ttaattttattcaaataaacgttagggtttgtgtta 10412796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0220 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: scaffold0220
Description:

Target: scaffold0220; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 20869 - 20943
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
20869 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagcatcattttg 20943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 82190 - 82116
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||    
82190 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattaatatcattttg 82116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 50808 - 50734
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
50808 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 50734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 50594 - 50638
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
50594 tgttatttttattcaaataaacgttagggtttgtgttatgtgggt 50638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 59; Significance: 1e-25; HSPs: 4)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 349191 - 349265
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||    
349191 tgttagttttattcaaataaacgttagagtttgcgttatgtgggtcctctaactttatttattagtatcattttg 349265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 349405 - 349361
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||| ||||  |||||||||||||||||    
349405 tgttaattttattcaaataaatgttagggtttgtgttatgtgggt 349361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #3
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 78
Target Start/End: Original strand, 113519 - 113558
Alignment:
39 ttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||| ||||||||||||||||    
113519 ttatgtggctcctctaactttatttattagtatcattttg 113558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #4
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 113698 - 113654
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||| |||||||||||||    
113698 tgttagttttattcaaataaacgttaaggttagtgttatgtgggt 113654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 59; Significance: 1e-25; HSPs: 23)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 9989441 - 9989515
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
9989441 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 9989515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2183058 - 2183135
Alignment:
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||  |||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
2183058 ttatgttagctttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 2183135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 34264674 - 34264606
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||    
34264674 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattaatatcattttg 34264606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 4 - 76
Target Start/End: Complemental strand, 35570112 - 35570040
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattt 76  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||    
35570112 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtatcattt 35570040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 11316076 - 11316150
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||| |||||||||||  ||||||||||||| |||||||||||||||| ||||||||||||||||    
11316076 tgttagttttattccaataaacgttagggtttgtgttatgtaggtcctctaactttatttattagtatcattttg 11316150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 24040419 - 24040349
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||||||||||    
24040419 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcttctaactttatttattagtatcat 24040349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 36440532 - 36440458
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   ||||||||||| |||||||||||||||||| ||||||||||||||||    
36440532 tgttagttttattcaaataaacgttggggtttgtgttatatgggtcctctaactttatttattagtatcattttg 36440458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 25567320 - 25567247
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||||||||||||| ||||| ||||||||| ||||||||||||||| ||||||||| |||||    
25567320 tgttagttttattcaaataaacgttagagtttttgttatgtgagtcctctaactttatttattagtattatttt 25567247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 37424597 - 37424520
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt---cctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||   ||||||||||||| ||||| ||||||||||    
37424597 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctcctctaactttatttattaatatcattttg 37424520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 32288408 - 32288335
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||  |||| ||||||||||||||||||||||||||||||| ||||||||| ||||||    
32288408 tgttagttttattcaaataat-gttagagtttgtgttatgtgggtcctctaactttatttattagtattattttg 32288335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 38959055 - 38958982
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| |||| | ||||||||||||| ||||||||||||||| ||| ||||||||||||    
38959055 tgttaattttattcaaataaa-gttagattttgtgttatgtgagtcctctaactttatttataagtatcattttg 38958982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 27185997 - 27186065
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||||| ||||||||||||||||| |||||  |||||||||||||||    
27185997 ttttattcaaataaatgttagggtttgttttatgtgggtcctctaattttattaattagtatcattttg 27186065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 9989655 - 9989611
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
9989655 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 9989611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 36440318 - 36440362
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
36440318 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36440362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 55
Target Start/End: Complemental strand, 39325687 - 39325636
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaa 55  Q
    ||||| ||||||||||||||||||||  ||||||||||||||| ||||||||    
39325687 tgttagttttattcaaataaacgttagggtttgtgttatgtggctcctctaa 39325636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 24040209 - 24040247
Alignment:
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
24040209 ttttattcaaataaacgttagagtttgtgttatgtgggt 24040247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 16860421 - 16860462
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
16860421 tgttagttttattcaaataaacgttagagtttgtgttatgtg 16860462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 25182985 - 25182941
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
25182985 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 25182941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 37424380 - 37424424
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
37424380 tgttagttttattcaaataaacgttagagtttgtgttatttgggt 37424424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 35569893 - 35569934
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
35569893 tgttagttttattcaaataaacgttagggtttgtgttatgtg 35569934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 6 - 46
Target Start/End: Complemental strand, 11316284 - 11316244
Alignment:
6 ttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||||||| |||||||||||  |||||||||||||||    
11316284 ttaattttattcgaataaacgttagggtttgtgttatgtgg 11316244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 27186205 - 27186161
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
27186205 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 27186161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 39325530 - 39325573
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  |||| |||||||||||    
39325530 tgttagttttattcaaataaacgttagggtttctgttatgtggg 39325573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0340
Description:

Target: scaffold0340; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 18391 - 18465
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||| ||||| ||||||||||||||||    
18391 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaattttatttattagtatcattttg 18465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 18605 - 18561
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
18605 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 18561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0221
Description:

Target: scaffold0221; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8546 - 8620
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   |||||||||||||||||||||||||||||| ||||||||||||||||    
8546 tgttagttttattcaaataaacgttgaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 8760 - 8716
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||| ||||    
8760 tgttagttttattcaaataaacgttagggtttgtgttatgcgggt 8716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0182
Description:

Target: scaffold0182; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 19826 - 19900
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |||||||||    
19826 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagcatcattttg 19900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 20040 - 19996
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
20040 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 19996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0134 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0134
Description:

Target: scaffold0134; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 14467 - 14393
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||| |||||||||    
14467 tgttagttttattcaaataaacgttagagtttgtgttatctgggtcctctaactttatttattagcatcattttg 14393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0134; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 14253 - 14297
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
14253 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 14297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 72880 - 72954
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
72880 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 72954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037 (Bit Score: 51; Significance: 6e-21; HSPs: 3)
Name: scaffold0037
Description:

Target: scaffold0037; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 45874 - 45948
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||  ||||||| ||||||||    
45874 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttacttattagtttcattttg 45948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 56468 - 56424
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
56468 tgttagttttattcaaataaacgttagggtttgttttatgtgggt 56424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037; HSP #3
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 63593 - 63549
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
63593 tgttagttttattcaaataaacgttagggtttgttttatgtgggt 63549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 48; Significance: 4e-19; HSPs: 2)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 15576 - 15639
Alignment:
14 attcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||||||||| |||  ||||||||||||||||||||||||||||||| |||||||||||||||    
15576 attcaaataaatgtttgagtttgtgttatgtgggtcctctaactttatttattagtatcatttt 15639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 15780 - 15736
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
15780 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 15736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0186 (Bit Score: 47; Significance: 2e-18; HSPs: 2)
Name: scaffold0186
Description:

Target: scaffold0186; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24280 - 24354
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| |||||  |||||||||    
24280 tgttagtttttttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattaacatcattttg 24354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0186; HSP #2
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 42
Target Start/End: Complemental strand, 24494 - 24456
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttat 42  Q
    ||||||||||||||||||||||||||  |||||||||||    
24494 tgttaattttattcaaataaacgttagggtttgtgttat 24456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0115 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: scaffold0115
Description:

Target: scaffold0115; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21630 - 21703
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
21630 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttattagtatcattttg 21703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246 (Bit Score: 44; Significance: 1e-16; HSPs: 2)
Name: scaffold0246
Description:

Target: scaffold0246; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 6116 - 6179
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtatta 67  Q
    ||||| |||||||||||||||| ||| |||||||||||||||| |||||||||||||| |||||    
6116 tgttagttttattcaaataaacattagagtttgtgttatgtggatcctctaactttatttatta 6179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 6327 - 6283
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
6327 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 6283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 34; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 14309 - 14350
Alignment:
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
14309 tgttagttttattcaaataaacgttagagtttgtgttatgtg 14350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93688 times since January 2019
Visitors: 2365