View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-23 (Length: 78)

Name: NF0440-3-1-Insertion-23
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-23
[»] chr3 (61 HSPs)
chr3 (1-78)||(32633323-32633400)
chr3 (4-78)||(22151963-22152037)
chr3 (4-78)||(44893858-44893932)
chr3 (4-78)||(8474104-8474178)
chr3 (4-78)||(10506206-10506280)
chr3 (4-78)||(21969747-21969821)
chr3 (4-78)||(21992183-21992257)
chr3 (4-78)||(26318440-26318514)
chr3 (4-78)||(39241476-39241550)
chr3 (4-78)||(42591902-42591976)
chr3 (4-78)||(47669377-47669451)
chr3 (4-78)||(54108160-54108234)
chr3 (4-78)||(54752281-54752355)
chr3 (1-78)||(39951472-39951549)
chr3 (10-78)||(12203809-12203877)
chr3 (4-78)||(1994426-1994500)
chr3 (4-78)||(4757751-4757825)
chr3 (4-78)||(5900681-5900755)
chr3 (4-78)||(15986353-15986427)
chr3 (4-78)||(39664442-39664516)
chr3 (10-78)||(11256227-11256295)
chr3 (11-78)||(22201741-22201808)
chr3 (4-78)||(16931724-16931798)
chr3 (4-78)||(27801607-27801681)
chr3 (4-78)||(29818295-29818369)
chr3 (4-78)||(51509377-51509451)
chr3 (1-78)||(18464571-18464648)
chr3 (10-78)||(28986400-28986468)
chr3 (4-78)||(53716412-53716485)
chr3 (4-78)||(47303277-47303348)
chr3 (4-78)||(4773361-4773434)
chr3 (4-78)||(21568864-21568937)
chr3 (10-78)||(24428691-24428759)
chr3 (10-78)||(41835184-41835252)
chr3 (4-78)||(46152733-46152805)
chr3 (4-48)||(12203669-12203713)
chr3 (10-78)||(19883363-19883431)
chr3 (4-48)||(54108020-54108064)
chr3 (4-48)||(54752451-54752495)
chr3 (1-48)||(24428855-24428902)
chr3 (6-48)||(19883528-19883570)
chr3 (1-46)||(44894030-44894075)
chr3 (4-48)||(4757612-4757656)
chr3 (4-48)||(27801777-27801821)
chr3 (4-48)||(28986278-28986322)
chr3 (4-48)||(39241646-39241690)
chr3 (4-48)||(39664302-39664346)
chr3 (4-47)||(47669548-47669591)
chr3 (1-48)||(51509234-51509281)
chr3 (1-48)||(53716581-53716628)
chr3 (4-45)||(8473964-8474005)
chr3 (4-45)||(26318300-26318341)
chr3 (4-48)||(21569033-21569077)
chr3 (4-48)||(21969917-21969961)
chr3 (4-48)||(21992353-21992397)
chr3 (4-48)||(22152133-22152177)
chr3 (4-48)||(29818465-29818509)
chr3 (1-45)||(46152904-46152948)
chr3 (4-48)||(47303137-47303181)
chr3 (1-48)||(4773530-4773577)
chr3 (4-39)||(12791473-12791508)
[»] chr8 (39 HSPs)
chr8 (4-78)||(7949530-7949604)
chr8 (4-78)||(38588705-38588779)
chr8 (1-78)||(7535091-7535168)
chr8 (10-78)||(45077461-45077529)
chr8 (4-78)||(5435158-5435232)
chr8 (4-78)||(15871879-15871953)
chr8 (4-77)||(18298488-18298561)
chr8 (4-78)||(5152792-5152866)
chr8 (4-78)||(15048517-15048591)
chr8 (4-78)||(27473329-27473403)
chr8 (4-78)||(33295942-33296016)
chr8 (4-78)||(45276854-45276928)
chr8 (4-78)||(1432249-1432323)
chr8 (4-78)||(27669534-27669608)
chr8 (5-78)||(44594859-44594932)
chr8 (1-76)||(11173894-11173969)
chr8 (5-78)||(37569573-37569646)
chr8 (4-78)||(40048177-40048247)
chr8 (4-78)||(1646765-1646838)
chr8 (4-78)||(1651830-1651903)
chr8 (4-78)||(1740206-1740279)
chr8 (4-78)||(1870051-1870125)
chr8 (1-48)||(45077317-45077364)
chr8 (1-48)||(15871736-15871783)
chr8 (1-48)||(38588875-38588922)
chr8 (10-48)||(33819909-33819947)
chr8 (4-48)||(5152652-5152696)
chr8 (4-48)||(5435018-5435062)
chr8 (4-48)||(34470832-34470876)
chr8 (4-48)||(40048342-40048386)
chr8 (4-47)||(1870224-1870267)
chr8 (19-78)||(11708008-11708067)
chr8 (4-45)||(15048690-15048731)
chr8 (4-48)||(7534951-7534995)
chr8 (4-48)||(27473189-27473233)
chr8 (4-48)||(37569432-37569476)
chr8 (10-46)||(40660107-40660143)
chr8 (4-43)||(40660179-40660218)
chr8 (1-48)||(45276712-45276759)
[»] chr7 (39 HSPs)
chr7 (4-78)||(10526429-10526503)
chr7 (1-78)||(28286375-28286452)
chr7 (4-78)||(28297937-28298011)
chr7 (4-78)||(33716706-33716780)
chr7 (4-78)||(41191943-41192017)
chr7 (4-78)||(44332777-44332851)
chr7 (1-70)||(40673271-40673340)
chr7 (4-75)||(1114172-1114243)
chr7 (4-78)||(6356883-6356957)
chr7 (4-78)||(17359299-17359373)
chr7 (4-78)||(34037169-34037243)
chr7 (4-78)||(36423487-36423561)
chr7 (4-78)||(48626321-48626395)
chr7 (13-78)||(7579130-7579195)
chr7 (10-78)||(19681753-19681821)
chr7 (10-78)||(31638201-31638269)
chr7 (4-74)||(8937111-8937181)
chr7 (4-78)||(41453263-41453337)
chr7 (4-61)||(7909404-7909461)
chr7 (4-78)||(6356404-6356477)
chr7 (4-78)||(8542617-8542691)
chr7 (4-78)||(21391448-21391522)
chr7 (4-66)||(27738935-27738997)
chr7 (4-78)||(41751768-41751842)
chr7 (10-78)||(43247540-43247607)
chr7 (4-48)||(28298107-28298151)
chr7 (4-46)||(21391308-21391350)
chr7 (4-48)||(36423657-36423701)
chr7 (1-48)||(17750050-17750097)
chr7 (4-48)||(7578990-7579034)
chr7 (4-48)||(28286235-28286279)
chr7 (4-48)||(35146817-35146861)
chr7 (4-48)||(41191800-41191844)
chr7 (1-48)||(33716872-33716919)
chr7 (4-53)||(4931556-4931605)
chr7 (4-45)||(48626181-48626222)
chr7 (4-48)||(1114333-1114377)
chr7 (4-48)||(8936967-8937011)
chr7 (4-48)||(10526598-10526642)
[»] chr4 (62 HSPs)
chr4 (4-78)||(21763439-21763513)
chr4 (10-78)||(1433529-1433597)
chr4 (4-78)||(19088599-19088673)
chr4 (4-78)||(19508671-19508745)
chr4 (4-78)||(24898307-24898381)
chr4 (4-78)||(30683786-30683860)
chr4 (4-78)||(33091711-33091785)
chr4 (4-78)||(42855597-42855671)
chr4 (4-78)||(46849927-46850001)
chr4 (1-78)||(6712078-6712155)
chr4 (5-78)||(38339611-38339684)
chr4 (1-78)||(44957504-44957581)
chr4 (4-78)||(8592087-8592161)
chr4 (4-78)||(14985449-14985523)
chr4 (4-78)||(15477903-15477977)
chr4 (4-78)||(16038052-16038126)
chr4 (4-78)||(37206685-37206759)
chr4 (4-78)||(39448746-39448820)
chr4 (4-78)||(43734544-43734618)
chr4 (4-78)||(44991536-44991610)
chr4 (4-78)||(50508715-50508789)
chr4 (4-78)||(52557345-52557419)
chr4 (4-78)||(53259396-53259470)
chr4 (4-78)||(53751160-53751234)
chr4 (10-78)||(12817930-12817998)
chr4 (10-78)||(50768945-50769013)
chr4 (4-78)||(623937-624011)
chr4 (4-78)||(25182070-25182144)
chr4 (4-78)||(41752074-41752148)
chr4 (1-78)||(53995192-53995268)
chr4 (10-78)||(36122691-36122759)
chr4 (4-78)||(23756058-23756132)
chr4 (4-78)||(43566636-43566710)
chr4 (10-78)||(41878117-41878185)
chr4 (1-48)||(36122548-36122595)
chr4 (4-48)||(52557205-52557249)
chr4 (10-48)||(21763305-21763343)
chr4 (10-48)||(53995058-53995096)
chr4 (4-49)||(12818093-12818138)
chr4 (1-46)||(23755533-23755578)
chr4 (4-48)||(14985619-14985663)
chr4 (4-48)||(16037912-16037956)
chr4 (4-48)||(19088459-19088503)
chr4 (4-48)||(24898477-24898521)
chr4 (4-48)||(46849787-46849831)
chr4 (4-48)||(53259256-53259300)
chr4 (10-45)||(30683651-30683686)
chr4 (1-48)||(43734401-43734448)
chr4 (4-46)||(37206545-37206587)
chr4 (4-46)||(38339782-38339824)
chr4 (4-45)||(1433389-1433430)
chr4 (4-48)||(6712251-6712295)
chr4 (4-48)||(15477763-15477807)
chr4 (46-78)||(23755676-23755708)
chr4 (4-48)||(33091571-33091615)
chr4 (4-48)||(39448606-39448650)
chr4 (4-48)||(41751934-41751978)
chr4 (4-48)||(42855457-42855501)
chr4 (10-46)||(43566502-43566538)
chr4 (4-48)||(44991397-44991441)
chr4 (4-44)||(50508575-50508615)
chr4 (4-44)||(53751020-53751060)
[»] chr2 (39 HSPs)
chr2 (4-78)||(26181958-26182032)
chr2 (4-78)||(34735601-34735675)
chr2 (4-78)||(2148144-2148218)
chr2 (4-78)||(8174143-8174217)
chr2 (4-78)||(10991969-10992043)
chr2 (4-78)||(13193106-13193180)
chr2 (4-78)||(16305143-16305217)
chr2 (4-78)||(24138764-24138838)
chr2 (4-78)||(7469284-7469358)
chr2 (4-78)||(12860625-12860699)
chr2 (4-78)||(15744575-15744649)
chr2 (4-78)||(19847576-19847650)
chr2 (4-78)||(29472360-29472434)
chr2 (4-69)||(36713706-36713771)
chr2 (1-78)||(41474197-41474274)
chr2 (10-78)||(19815962-19816030)
chr2 (4-78)||(17052175-17052250)
chr2 (4-78)||(7496237-7496311)
chr2 (4-78)||(15406014-15406088)
chr2 (4-78)||(24372225-24372299)
chr2 (4-78)||(38332822-38332896)
chr2 (4-61)||(33470198-33470255)
chr2 (4-48)||(2148004-2148048)
chr2 (4-48)||(10992139-10992183)
chr2 (4-48)||(15405874-15405918)
chr2 (1-44)||(7469458-7469501)
chr2 (10-48)||(13193276-13193314)
chr2 (10-48)||(36713873-36713911)
chr2 (4-45)||(41474373-41474414)
chr2 (4-48)||(7496098-7496142)
chr2 (4-48)||(8174003-8174047)
chr2 (10-48)||(34735467-34735505)
chr2 (4-46)||(42834540-42834582)
chr2 (4-45)||(19815822-19815863)
chr2 (4-45)||(29472533-29472574)
chr2 (4-48)||(12860498-12860542)
chr2 (4-48)||(16305313-16305357)
chr2 (4-48)||(17052342-17052386)
chr2 (4-48)||(24372085-24372129)
[»] chr1 (50 HSPs)
chr1 (4-78)||(45052947-45053021)
chr1 (4-78)||(1762932-1763006)
chr1 (4-78)||(2064469-2064543)
chr1 (4-78)||(9006449-9006523)
chr1 (4-78)||(38127827-38127901)
chr1 (4-78)||(49140401-49140475)
chr1 (4-77)||(27400683-27400756)
chr1 (4-78)||(12127311-12127385)
chr1 (4-78)||(12481317-12481391)
chr1 (4-78)||(23476599-23476673)
chr1 (4-78)||(37304146-37304220)
chr1 (4-78)||(37576299-37576373)
chr1 (1-78)||(6798065-6798142)
chr1 (1-78)||(37284986-37285063)
chr1 (1-78)||(37585951-37586028)
chr1 (10-77)||(4330096-4330163)
chr1 (12-78)||(16024023-16024089)
chr1 (4-78)||(27547927-27548001)
chr1 (4-78)||(31703732-31703806)
chr1 (4-78)||(35612340-35612414)
chr1 (4-78)||(45843375-45843449)
chr1 (4-78)||(49643929-49644002)
chr1 (10-78)||(20306126-20306194)
chr1 (11-78)||(8762657-8762724)
chr1 (4-78)||(3089460-3089534)
chr1 (4-78)||(25995902-25995976)
chr1 (5-78)||(39486451-39486523)
chr1 (1-48)||(37304316-37304363)
chr1 (10-48)||(49140267-49140305)
chr1 (41-78)||(26707454-26707491)
chr1 (4-48)||(4697000-4697044)
chr1 (4-48)||(6797925-6797969)
chr1 (4-48)||(9006309-9006353)
chr1 (4-48)||(25996072-25996116)
chr1 (4-48)||(26707314-26707358)
chr1 (4-44)||(37585811-37585851)
chr1 (4-48)||(39486320-39486364)
chr1 (42-78)||(44322816-44322852)
chr1 (10-48)||(20306290-20306328)
chr1 (4-45)||(12127175-12127216)
chr1 (46-78)||(4697140-4697172)
chr1 (4-48)||(12481177-12481221)
chr1 (4-48)||(23476459-23476503)
chr1 (4-48)||(37576469-37576513)
chr1 (10-42)||(38000613-38000645)
chr1 (4-48)||(44322948-44322992)
chr1 (4-48)||(49643789-49643833)
chr1 (1-48)||(1762789-1762836)
chr1 (1-48)||(8760387-8760434)
chr1 (10-45)||(35612206-35612241)
[»] chr6 (44 HSPs)
chr6 (1-78)||(18053071-18053148)
chr6 (4-78)||(3423428-3423502)
chr6 (4-78)||(5938071-5938145)
chr6 (4-78)||(7270747-7270821)
chr6 (4-78)||(24744446-24744520)
chr6 (4-78)||(26600475-26600549)
chr6 (4-78)||(34890762-34890836)
chr6 (4-78)||(5310944-5311018)
chr6 (4-78)||(5639431-5639505)
chr6 (4-78)||(9046204-9046278)
chr6 (4-78)||(21540235-21540309)
chr6 (4-78)||(31247234-31247308)
chr6 (4-78)||(32993273-32993347)
chr6 (1-78)||(26957077-26957154)
chr6 (1-78)||(34994638-34994715)
chr6 (4-77)||(35167751-35167824)
chr6 (4-71)||(6532310-6532377)
chr6 (4-78)||(6137636-6137709)
chr6 (4-78)||(21856813-21856887)
chr6 (4-78)||(25176915-25176989)
chr6 (4-78)||(31237864-31237938)
chr6 (10-78)||(7270077-7270145)
chr6 (4-78)||(2517120-2517194)
chr6 (4-71)||(32753295-32753362)
chr6 (4-74)||(6236183-6236253)
chr6 (1-48)||(5311114-5311161)
chr6 (4-48)||(7270241-7270285)
chr6 (4-48)||(31238034-31238078)
chr6 (4-48)||(31247404-31247448)
chr6 (4-48)||(978533-978577)
chr6 (4-48)||(5937931-5937975)
chr6 (4-48)||(6236039-6236083)
chr6 (4-48)||(21856673-21856717)
chr6 (4-48)||(26600635-26600679)
chr6 (4-48)||(32753461-32753505)
chr6 (4-48)||(34994498-34994542)
chr6 (4-48)||(35167608-35167652)
chr6 (10-48)||(3423294-3423332)
chr6 (10-48)||(5639297-5639335)
chr6 (10-48)||(24744609-24744647)
chr6 (4-48)||(9046374-9046418)
chr6 (4-48)||(15932844-15932888)
chr6 (4-48)||(34890932-34890976)
chr6 (6-41)||(10412796-10412831)
[»] scaffold0220 (1 HSPs)
scaffold0220 (4-78)||(20869-20943)
[»] scaffold0032 (1 HSPs)
scaffold0032 (4-78)||(82116-82190)
[»] scaffold0019 (2 HSPs)
scaffold0019 (4-78)||(50734-50808)
scaffold0019 (4-48)||(50594-50638)
[»] scaffold0003 (4 HSPs)
scaffold0003 (4-78)||(349191-349265)
scaffold0003 (4-48)||(349361-349405)
scaffold0003 (39-78)||(113519-113558)
scaffold0003 (4-48)||(113654-113698)
[»] chr5 (23 HSPs)
chr5 (4-78)||(9989441-9989515)
chr5 (1-78)||(2183058-2183135)
chr5 (10-78)||(34264606-34264674)
chr5 (4-76)||(35570040-35570112)
chr5 (4-78)||(11316076-11316150)
chr5 (4-74)||(24040349-24040419)
chr5 (4-78)||(36440458-36440532)
chr5 (4-77)||(25567247-25567320)
chr5 (4-78)||(37424520-37424597)
chr5 (4-78)||(32288335-32288408)
chr5 (4-78)||(38958982-38959055)
chr5 (10-78)||(27185997-27186065)
chr5 (4-48)||(9989611-9989655)
chr5 (4-48)||(36440318-36440362)
chr5 (4-55)||(39325636-39325687)
chr5 (10-48)||(24040209-24040247)
chr5 (4-45)||(16860421-16860462)
chr5 (4-48)||(25182941-25182985)
chr5 (4-48)||(37424380-37424424)
chr5 (4-45)||(35569893-35569934)
chr5 (6-46)||(11316244-11316284)
chr5 (4-48)||(27186161-27186205)
chr5 (4-47)||(39325530-39325573)
[»] scaffold0340 (2 HSPs)
scaffold0340 (4-78)||(18391-18465)
scaffold0340 (4-48)||(18561-18605)
[»] scaffold0221 (2 HSPs)
scaffold0221 (4-78)||(8546-8620)
scaffold0221 (4-48)||(8716-8760)
[»] scaffold0182 (2 HSPs)
scaffold0182 (4-78)||(19826-19900)
scaffold0182 (4-48)||(19996-20040)
[»] scaffold0134 (2 HSPs)
scaffold0134 (4-78)||(14393-14467)
scaffold0134 (4-48)||(14253-14297)
[»] scaffold0029 (1 HSPs)
scaffold0029 (4-78)||(72880-72954)
[»] scaffold0037 (3 HSPs)
scaffold0037 (4-78)||(45874-45948)
scaffold0037 (4-48)||(56424-56468)
scaffold0037 (4-48)||(63549-63593)
[»] scaffold0072 (2 HSPs)
scaffold0072 (14-77)||(15576-15639)
scaffold0072 (4-48)||(15736-15780)
[»] scaffold0186 (2 HSPs)
scaffold0186 (4-78)||(24280-24354)
scaffold0186 (4-42)||(24456-24494)
[»] scaffold0115 (1 HSPs)
scaffold0115 (4-78)||(21630-21703)
[»] scaffold0246 (2 HSPs)
scaffold0246 (4-67)||(6116-6179)
scaffold0246 (4-48)||(6283-6327)
[»] scaffold0260 (1 HSPs)
scaffold0260 (4-45)||(14309-14350)

Alignment Details
Target: chr3 (Bit Score: 66; Significance: 7e-30; HSPs: 61)
Name: chr3

Target: chr3; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 32633400 - 32633323
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
32633400 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 32633323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 22151963 - 22152037
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||    
22151963 tgttaattttattcaaataaacgatagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 22152037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 44893858 - 44893932
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
44893858 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 44893932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 8474178 - 8474104
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
8474178 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8474104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 10506280 - 10506206
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
10506280 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 10506206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21969747 - 21969821
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||    
21969747 tgttacttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcgttttg 21969821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21992183 - 21992257
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||    
21992183 tgttacttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcgttttg 21992257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 26318514 - 26318440
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
26318514 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26318440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 39241476 - 39241550
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
39241476 tgttagttttattcaaataaacgttaatgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 39241550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 42591902 - 42591976
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
42591902 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 42591976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 47669377 - 47669451
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
47669377 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 47669451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 54108234 - 54108160
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
54108234 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 54108160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 54752281 - 54752355
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||    
54752281 tgttagttttattcaaataaacattatggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 54752355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 39951472 - 39951549
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||||||||||    
39951472 ttatgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctttaactttatttattagtatcattttg 39951549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 12203877 - 12203809
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||    
12203877 ttttattcaaataaacgttagagtttgtgttatgtgggacctctaactttatttattagtatcattttg 12203809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1994500 - 1994426
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
1994500 tgttatttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 1994426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 4757825 - 4757751
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
4757825 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 4757751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5900755 - 5900681
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
5900755 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 5900681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15986353 - 15986427
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| |||||||||||||||||| |||||||||||| ||||||||||||||||    
15986353 tgttagttttattcaaataaatgttagagtttgtgttatgtgggttctctaactttatttattagtatcattttg 15986427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 39664516 - 39664442
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
39664516 tgttagttttattcaaataaatgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 39664442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 11256227 - 11256295
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||| ||||||||| ||||||||||||||| ||||||||||||||||    
11256227 ttttattcaaataaacgttagagtttctgttatgtgtgtcctctaactttatttattagtatcattttg 11256295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 11 - 78
Target Start/End: Original strand, 22201741 - 22201808
11 tttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
22201741 tttattcaaataaacgttaaggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 22201808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 16931724 - 16931798
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||| |||||| ||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
16931724 tgttagttttatacaaatatacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 16931798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 27801607 - 27801681
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| |||||||||| |||||||||||||| ||||| ||||||||||    
27801607 tgttagttttattcaaataaacgttagagtttctgttatgtggatcctctaactttatttattaatatcattttg 27801681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 29818295 - 29818369
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| ||| |||||||||||||| ||||||||||||||||    
29818295 tgttagttttattcaaataaacgttagggtttgtgttatatggatcctctaactttatttattagtatcattttg 29818369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 51509451 - 51509377
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
51509451 tgttagttttattcaaataaatgttagggtttgtattatgtgggtcctctaactttatttattagtatcattttg 51509377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 18464571 - 18464648
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  ||||||||||||| |||||| || |||||| ||||||||||||||||    
18464571 ttatgttagttttattcaaataaacgttagggtttgtgttatgtaggtcctatagctttatttattagtatcattttg 18464648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 28986468 - 28986400
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||  ||||||||||| || ||||||||||||||| ||||||||||||||||    
28986468 ttttattcaaataaacgttagggtttgtgttatatgagtcctctaactttatttattagtatcattttg 28986400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 53716412 - 53716485
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||| ||||| ||||||||||||| ||||||||||||||||    
53716412 tgttagttttattcaaataaacgttagggtttgtgttacgtggg-cctctaactttatttattagtatcattttg 53716485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 47303348 - 47303277
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||  |||||||||||||||||||||| ||||| ||||||||||    
47303348 tgttagttttattcaaataaacgttagagtttgt--tatgtgggtcctctaactttatttatta-tatcattttg 47303277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 4773361 - 4773434
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||| ||||||||||||||||||||||||| ||||||||||||||||    
4773361 tgttagttttattcaaataaa-gttaggttttttgttatgtgggtcctctaactttatttattagtatcattttg 4773434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21568864 - 21568937
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||||||||||| ||||||||||| |||| ||||||||||||||||    
21568864 tgttagttttattcaaataaatgttagggtttgtgttatgt-ggtcctctaaccttatttattagtatcattttg 21568937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 24428691 - 24428759
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||    |||||||||||||| ||||||||||| || ||||||||||||||||    
24428691 ttttattcaaataaacgttgggatttgtgttatgtggatcctctaacttaatttattagtatcattttg 24428759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 41835252 - 41835184
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||||||||  ||||||||||  |||||| ||||||||||| ||||||||||||||||    
41835252 ttttatttaaataaacgttagtgtttgtgttacatgggtcatctaactttatttattagtatcattttg 41835184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 46152733 - 46152805
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||  | ||||||||||| ||||||||||||||||    
46152733 tgttagttttattcaaataaacgttagggtttgtgttatctgg--catctaactttatttattagtatcattttg 46152805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12203669 - 12203713
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||||||||  |||||||||||||||||    
12203669 tgttaattttattcaaataaacgttagggtttgtgttatgtgggt 12203713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 19883363 - 19883431
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||||||||  |||||||||||||| || |  ||||||||| ||||||||||||||||    
19883363 ttttatttaaataaacgttagggtttgtgttatgtgagtaccttaactttatttattagtatcattttg 19883431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 54108020 - 54108064
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
54108020 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 54108064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 54752495 - 54752451
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
54752495 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 54752451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24428902 - 24428855
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
24428902 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 24428855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 19883570 - 19883528
6 ttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||||||  |||||||||||||||||    
19883570 ttaattttattcaaataaacgttagggtttgtgttatgtgggt 19883528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 44894075 - 44894030
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||| |||||||||||||||| ||| ||||||||||||||||    
44894075 ttatgttagttttattcaaataaacattagagtttgtgttatgtgg 44894030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 4757612 - 4757656
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
4757612 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 4757656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 27801821 - 27801777
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
27801821 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 27801777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 28986278 - 28986322
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||    
28986278 tgttagttttattcaaataaacgttagagtttgtattatgtgggt 28986322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 39241690 - 39241646
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | ||||||||||||||||    
39241690 tgttagttttattcaaataaacgttagaatttgtgttatgtgggt 39241646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39664302 - 39664346
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
39664302 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 39664346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 47669591 - 47669548
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||    
47669591 tgttagttttattcaaataaacgttagggtttgtgttatgtggg 47669548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 51509234 - 51509281
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||   ||||||||||||||||    
51509234 ttatgttagttttattcaaataaacgttaggatttgtgttatgtgggt 51509281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 53716628 - 53716581
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||| |||||||  |||||||||||||||||    
53716628 ttatgttagttttattcaaattaacgttagggtttgtgttatgtgggt 53716581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 8473964 - 8474005
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
8473964 tgttagttttattcaaataaacgttatgatttgtgttatgtg 8474005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 26318300 - 26318341
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
26318300 tgttagttttattcaaataaacgttatgatttgtgttatgtg 26318341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21569077 - 21569033
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
21569077 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 21569033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21969961 - 21969917
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
21969961 tgttagttttatttaaataaacgttagggtttgtgttatgtgggt 21969917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 21992397 - 21992353
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
21992397 tgttagttttatttaaataaacgttagggtttgtgttatgtgggt 21992353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 22152177 - 22152133
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
22152177 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 22152133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 29818509 - 29818465
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  | |||||||||||||||    
29818509 tgttagttttattcaaataaacgttagggattgtgttatgtgggt 29818465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 46152948 - 46152904
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    |||||||| |||||||||||||||||||   ||||||||||||||    
46152948 ttatgttagttttattcaaataaacgttgaggtttgtgttatgtg 46152904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 47303137 - 47303181
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
47303137 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 47303181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4773577 - 4773530
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||| |  ||||||| |||||||||    
4773577 ttatgttagttttattcaaataaacgtcaaggtttgtgctatgtgggt 4773530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 39
Target Start/End: Complemental strand, 12791508 - 12791473
4 tgttaattttattcaaataaacgttatagtttgtgt 39  Q
    ||||| |||||||||||||||||||| |||||||||    
12791508 tgttagttttattcaaataaacgttagagtttgtgt 12791473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr8

Target: chr8; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7949530 - 7949604
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
7949530 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7949604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38588705 - 38588779
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
38588705 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 38588779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 7535168 - 7535091
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||    
7535168 ttatgttagttttattcaaataaacgttatagtttgtgttatgtgagtcctctagctttatttattagtatcattttg 7535091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 45077529 - 45077461
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
45077529 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 45077461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5435232 - 5435158
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||    
5435232 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcatctaactttatttattagtatcattttg 5435158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15871953 - 15871879
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||    
15871953 tgttagttttattcaaataaacgttagagcttgtgttatgtgggtcctctaactttatttattagtatcattttg 15871879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 18298561 - 18298488
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||    
18298561 tgttagttttattcaaataaacgttagagtttgtgttatgtgagtcctctaactttatttattagtatcatttt 18298488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5152866 - 5152792
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| || |||||||||||||    
5152866 tgttagttttattcaaataaacgttagagtttgtgttatatgggtcctctaactttatttactagtatcattttg 5152792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15048517 - 15048591
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
15048517 tgttagttttattcaaataaacgttagggtttttgttatgtgggtcctctaactttatttattagtatcattttg 15048591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 27473403 - 27473329
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||| |||||||||||||||| ||||||||||||||||    
27473403 tgttagttttattcaaataaacgttagggtttgtgttatgtaggtcctctaactttatttattagtatcattttg 27473329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 33296016 - 33295942
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
33296016 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 33295942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45276928 - 45276854
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  | |||||||||||||||||||||||||||| ||||||||||||||||    
45276928 tgttagttttattcaaataaacgttagggattgtgttatgtgggtcctctaactttatttattagtatcattttg 45276854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 1432249 - 1432323
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||||||||||||||| ||||| ||||||||||    
1432249 tgttagttttattcaaataaacgttagggtttgtgttatttgggtcctctaactttatttattaatatcattttg 1432323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 27669534 - 27669608
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||| ||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
27669534 tgttagttttattgaaataaacgttagggtttatgttatgtgggtcctctaactttatttattagtatcattttg 27669608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 44594932 - 44594859
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||| ||||||    
44594932 gttagttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtattattttg 44594859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 11173969 - 11173894
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattt 76  Q
    |||||||| ||||||||||||||| |||| |||||   ||||||||||||||||||||||| ||||||||||||||    
11173969 ttatgttagttttattcaaataaatgttagagtttagattatgtgggtcctctaactttatttattagtatcattt 11173894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 37569646 - 37569573
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| |||||||||||||||||||| ||||| || || |||||| |||||||||||| ||||||||||||||||    
37569646 gttagttttattcaaataaacgttagagtttatgctacgtgggttctctaactttatttattagtatcattttg 37569573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 40048177 - 40048247
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||    ||||||||||||||| ||||||||||||||||    
40048177 tgttagttttattcaaataaacgttaaagtttgtgttat----gtcctctaactttatttattagtatcattttg 40048247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1646838 - 1646765
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||| ||||||||||||||||||||||||| ||||||||||||||||    
1646838 tgttagttttattcaaataaa-gttaggttttatgttatgtgggtcctctaactttatttattagtatcattttg 1646765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1651903 - 1651830
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| | ||||||||||||||    
1651903 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttgttagtatcattttg 1651830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1740279 - 1740206
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| | ||||||||||||||    
1740279 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttgttagtatcattttg 1740206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 1870051 - 1870125
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||   ||||||||| |||||||||| ||||||||||||||||    
1870051 tgttagttttattcaaataaacgttagggtttgtgaattgtgggtcccctaactttatttattagtatcattttg 1870125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45077317 - 45077364
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||    
45077317 ttatgttagttttattcaaataaacgttatggtttgtgttatgtgggt 45077364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 15871736 - 15871783
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
15871736 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 15871783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38588922 - 38588875
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||||||  |||||| ||||||||||    
38588922 ttatgttaattttattcaaataaacgttagggtttgtattatgtgggt 38588875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 33819909 - 33819947
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
33819909 ttttattcaaataaacgttagagtttgtgttatgtgggt 33819947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5152652 - 5152696
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5152652 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5152696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5435018 - 5435062
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5435018 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5435062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 34470876 - 34470832
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
34470876 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggt 34470832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 40048386 - 40048342
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
40048386 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggt 40048342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 1870267 - 1870224
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||    
1870267 tgttagttttattcaaataaacgttagggtttgtgttatgtggg 1870224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 11708067 - 11708008
19 aataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||  | || | ||||||||||| ||||||||||| ||||||||||||||||    
11708067 aataaacgttagggcttatattatgtgggtcatctaactttatttattagtatcattttg 11708008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 15048731 - 15048690
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
15048731 tgttagttttattcaaataaacgttatgatttgtgttatgtg 15048690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7534951 - 7534995
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
7534951 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 7534995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 27473189 - 27473233
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| ||||  ||||||||||||||||    
27473189 tgttagttttattcaaataaacattatgatttgtgttatgtgggt 27473233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 37569432 - 37569476
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||| |||||||||||| |||| ||||||||||||    
37569432 tgttagttttattcgaataaacgttatggtttttgttatgtgggt 37569476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 40660107 - 40660143
10 ttttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||||||||||||||||||  |||||||||||||||    
40660107 ttttattcaaataaacgttagggtttgtgttatgtgg 40660143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 43
Target Start/End: Complemental strand, 40660218 - 40660179
4 tgttaattttattcaaataaacgttatagtttgtgttatg 43  Q
    ||||| |||||||||||||||||||| ||||||| |||||    
40660218 tgttagttttattcaaataaacgttagagtttgtattatg 40660179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 45276712 - 45276759
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||| ||| ||||||||||||||| ||||  |||||||||||||||||    
45276712 ttatattagttttattcaaataaatgttagggtttgtgttatgtgggt 45276759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr7

Target: chr7; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 10526429 - 10526503
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
10526429 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 10526503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 28286452 - 28286375
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
28286452 ttatattagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 28286375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 28297937 - 28298011
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
28297937 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 28298011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 33716706 - 33716780
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||    
33716706 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagtatcattttg 33716780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41192017 - 41191943
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
41192017 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 41191943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 44332851 - 44332777
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
44332851 tgttagttttattcaaataaacgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 44332777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 40673340 - 40673271
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagta 70  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
40673340 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagta 40673271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 56; E-Value: 7e-24
Query Start/End: Original strand, 4 - 75
Target Start/End: Original strand, 1114172 - 1114243
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatt 75  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||    
1114172 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagcatcatt 1114243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 6356883 - 6356957
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
6356883 tgttagttttattcaaataaatgttagtgtttgtgttatgtgggtcctctaactttatttattagtatcattttg 6356957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 17359299 - 17359373
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||||||    
17359299 tgttagttttattcaaataaacattagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 17359373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 34037243 - 34037169
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||| ||||||||||    
34037243 tgttagttttattcaaataaacgttagagtttatgttatgtgggtcctctaactttatttattaatatcattttg 34037169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 36423487 - 36423561
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
36423487 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 36423561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 48626395 - 48626321
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
48626395 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 48626321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 7579195 - 7579130
13 tattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||    
7579195 tattcaaataaacgttatggtttttgttatgtgggtcctctaactttatttattagtatcattttg 7579130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 19681821 - 19681753
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
19681821 ttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 19681753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 31638269 - 31638201
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| |||||||| |||||| |||||||||||||| ||||||||||||||||    
31638269 ttttattcaaataaacgttatggtttgtgtcatgtggatcctctaactttatttattagtatcattttg 31638201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 8937181 - 8937111
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||| ||||||    
8937181 tgttagttttattcaaataaacgttatggtttgtgttatgtgggttctctaactttatttattaatatcat 8937111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41453337 - 41453263
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
41453337 tgttagttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 41453263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 4 - 61
Target Start/End: Original strand, 7909404 - 7909461
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttat 61  Q
    ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7909404 tgttagttttattcaaataaacgttatagtttgtgttatgtggatcctctaactttat 7909461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 6356404 - 6356477
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| | |||||||||| |||||||||||||||||| ||||||||||||||||    
6356404 tgttagttttattcaaataaa-gttagattttgtgttatatgggtcctctaactttatttattagtatcattttg 6356477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8542617 - 8542691
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||| | |||||||||| |||||||| ||||||||||| |||||| |||||||||    
8542617 tgttagttttattcaaataaacgtcagagtttgtgttgtgtgggtcttctaactttatttattagcatcattttg 8542691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21391522 - 21391448
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||||||||||||| || ||||||||||| ||||||||||||||||    
21391522 tgttagttttattcaaataaatgttagtgtttgtgttatgtggatcatctaactttatttattagtatcattttg 21391448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 66
Target Start/End: Complemental strand, 27738997 - 27738935
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtatt 66  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||    
27738997 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttatt 27738935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 41751768 - 41751842
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||| || ||||||||||| ||||||||| ||||||    
41751768 tgttagttttattcaaataaacgttagggtttgtgttatgtggatcttctaactttatttattagtattattttg 41751842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 43247540 - 43247607
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| |||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
43247540 ttttattcaaataaacattag-gtttatgttatgtgggtcctctaactttatttattagtatcattttg 43247607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 28298151 - 28298107
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||| ||||||||||||||||||    
28298151 tgttaattttattcaaataaacgttagagtttgtgttatgtgggt 28298107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 21391308 - 21391350
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
21391308 tgttaattttattcaaataaacgttagagtttgtgttatgtgg 21391350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 36423701 - 36423657
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
36423701 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36423657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 17750050 - 17750097
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||| ||||||||||| |||||    
17750050 ttatgttagttttattcaaataaacgttatggtttgtgttatatgggt 17750097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7578990 - 7579034
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
7578990 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 7579034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 28286235 - 28286279
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
28286235 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 28286279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 35146817 - 35146861
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
35146817 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 35146861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 41191800 - 41191844
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
41191800 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 41191844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33716919 - 33716872
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||| |||||||||||||||  ||| |||||||||||||    
33716919 ttatgttaattttgttcaaataaacgttagggttggtgttatgtgggt 33716872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 4931605 - 4931556
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctct 53  Q
    ||||| |||||||||||||||||||| | ||||||||||||  |||||||    
4931605 tgttagttttattcaaataaacgttagaatttgtgttatgtaagtcctct 4931556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 48626181 - 48626222
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
48626181 tgttagttttattcaaataaacgttatgatttgtgttatgtg 48626222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 1114377 - 1114333
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
1114377 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 1114333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 8936967 - 8937011
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
8936967 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 8937011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 10526642 - 10526598
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
10526642 tgttagttttattcaaataaacgttaagttttgtgttatgtgggt 10526598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 63; Significance: 4e-28; HSPs: 62)
Name: chr4

Target: chr4; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21763513 - 21763439
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
21763513 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 21763439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 1433597 - 1433529
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
1433597 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 1433529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19088673 - 19088599
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
19088673 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 19088599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19508745 - 19508671
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||    
19508745 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatgattttg 19508671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24898307 - 24898381
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
24898307 tgttagttttattcaaataaacgttagagtttgtgttatgtgcgtcctctaactttatttattagtatcattttg 24898381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 30683860 - 30683786
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
30683860 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 30683786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 33091785 - 33091711
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
33091785 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 33091711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 42855671 - 42855597
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
42855671 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 42855597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 46850001 - 46849927
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
46850001 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 46849927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 6712078 - 6712155
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||| ||||||||||||||||||||||||| ||||||||||||||||    
6712078 ttatgttagttttattcaaataaacgttagggtttctgttatgtgggtcctctaactttatttattagtatcattttg 6712155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 38339611 - 38339684
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
38339611 gttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 38339684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 44957504 - 44957581
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||||||||||    
44957504 ttatgttagttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtatcattttg 44957581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8592087 - 8592161
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
8592087 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 8592161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 14985449 - 14985523
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||| |||||||||||||||||||||||||| ||||||||||||||||    
14985449 tgttagttttattcaaataaacgttagggttcgtgttatgtgggtcctctaactttatttattagtatcattttg 14985523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15477977 - 15477903
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||||||||||||||    
15477977 tgttagttttattcaaataaacgttagagtttgtgttacgtgggtcctctaactttgtttattagtatcattttg 15477903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 16038126 - 16038052
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
16038126 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 16038052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 37206759 - 37206685
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
37206759 tgttagttttattcaaataaacgttaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 37206685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 39448820 - 39448746
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||| |||||||||    
39448820 tgttagttttattcaaataaacgttagagtttgtgttatctgggtcctctaactttatttattagcatcattttg 39448746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 43734618 - 43734544
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
43734618 tgttagttttattcaaataaacgttaagatttgtgttatgtgggtcctctaactttatttattagtatcattttg 43734544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 44991610 - 44991536
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
44991610 tgttagttttgttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 44991536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 50508789 - 50508715
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||| ||||||    
50508789 tgttagttttattcaaataaacgttatggtttatgttatgtgggtcctctaactttatttattagtattattttg 50508715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 52557419 - 52557345
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| |||||||| |||||||||||||| ||||||||||||||||    
52557419 tgttagttttattcaaataaacgttagagtttgtattatgtggatcctctaactttatttattagtatcattttg 52557345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 53259470 - 53259396
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||| |||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||    
53259470 tgttagttttattcaaatacacgttagagtttgtgttatgtgagtcctctaactttatttattagtatcattttg 53259396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 53751234 - 53751160
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||| ||||||    
53751234 tgttagttttattcaaataaacgttatgatttgtgttatgtgggtcctctaactttatttattagtataattttg 53751160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 12817930 - 12817998
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||| ||||||||||||    
12817930 ttttattcaaataaacgttagagtttgtgttatgtgggtcctgtaactttatttatcagtatcattttg 12817998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 50768945 - 50769013
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||  ||||||||||||||| |||||||||||||| ||||||||||||||||    
50768945 ttttattcaaataaacgttagggtttgtgttatgtggatcctctaactttatttattagtatcattttg 50769013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 624011 - 623937
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| |||||||||||||||| |||||||||||||| |||||| |||||||||    
624011 tgttagttttattcaaataaatgttagagtttgtgttatgtggatcctctaactttatttattagcatcattttg 623937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 25182144 - 25182070
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||  |||||||||    
25182144 tgttagttttattcaaataaacgtttgagtttgtgttatgtgggtcctctaactttatttattaacatcattttg 25182070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 41752148 - 41752074
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||| ||||| ||||| ||||||||||    
41752148 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaattttatttattaatatcattttg 41752074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 53995268 - 53995192
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||| ||||||||||    
53995268 ttatgttagttttattcaaataa-cgttagggtttgtgttatgtgggtcctctaactttatttattaatatcattttg 53995192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 36122759 - 36122691
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| |||||||||||| | |||||||||||| ||| ||||||||||||||||    
36122759 ttttattcaaataaacgttagagtttgtgttatataggtcctctaactatatttattagtatcattttg 36122691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 23756132 - 23756058
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  ||||| ||||||||| |||||||||||||| ||||||||||||||||    
23756132 tgttagttttattcaaataaatgttagggtttgcgttatgtggatcctctaactttatttattagtatcattttg 23756058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 43566710 - 43566636
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||| ||||||||||||   |||||||||||||||||||| |||||||| ||||||||||||||||    
43566710 tgttagttttatttaaataaacgttaggatttgtgttatgtgggtcctcaaactttatttattagtatcattttg 43566636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 41878185 - 41878117
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||| |||||||||||||||| |||||||| ||||||||||||||||    
41878185 ttttattcaaataaatgttagggtttatgttatgtgggtcctccaactttatttattagtatcattttg 41878117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 36122548 - 36122595
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||    
36122548 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36122595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 52557205 - 52557249
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
52557205 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 52557249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 21763305 - 21763343
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
21763305 ttttattcaaataaacgttagagtttgtgttatgtgggt 21763343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 53995058 - 53995096
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
53995058 ttttattcaaataaacgttagagtttgtgttatgtgggt 53995096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 12818138 - 12818093
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtc 49  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||    
12818138 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtc 12818093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 23755533 - 23755578
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||| |||||||||||||||||||| ||||||||||| ||||    
23755533 ttatgttagttttattcaaataaacgttaaagtttgtgttacgtgg 23755578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 14985663 - 14985619
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
14985663 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 14985619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 16037912 - 16037956
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
16037912 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 16037956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 19088459 - 19088503
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
19088459 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 19088503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 24898521 - 24898477
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
24898521 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 24898477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 46849787 - 46849831
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
46849787 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 46849831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 53259256 - 53259300
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
53259256 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 53259300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 30683651 - 30683686
10 ttttattcaaataaacgttatagtttgtgttatgtg 45  Q
    |||||||||||||||||||| |||||||||||||||    
30683651 ttttattcaaataaacgttagagtttgtgttatgtg 30683686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 43734401 - 43734448
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||   ||||||||||||||||    
43734401 ttatgttagttttattcaaataaacgttaggatttgtgttatgtgggt 43734448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 37206545 - 37206587
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
37206545 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 37206587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Complemental strand, 38339824 - 38339782
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
38339824 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 38339782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 1433389 - 1433430
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
1433389 tgttagttttattcaaataaacgttagggtttgtgttatgtg 1433430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 6712295 - 6712251
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
6712295 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 6712251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 15477763 - 15477807
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| ||||||||||||  |||||||||||||||||    
15477763 tgttagttttattaaaataaacgttagtgtttgtgttatgtgggt 15477807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 23755708 - 23755676
46 ggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| ||||||||||||||||    
23755708 ggtcctctaactttatttattagtatcattttg 23755676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 33091571 - 33091615
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
33091571 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 33091615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39448606 - 39448650
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||| |||||| ||||| ||||||||||||||||||    
39448606 tgttagttttatttaaataagcgttagagtttgtgttatgtgggt 39448650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 41751934 - 41751978
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
41751934 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 41751978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 42855457 - 42855501
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
42855457 tgttagttttattcaaataaaggttagggtttgtgttatgtgggt 42855501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 43566502 - 43566538
10 ttttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||||||||||||||||||  |||||||||||||||    
43566502 ttttattcaaataaacgttagggtttgtgttatgtgg 43566538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 44991397 - 44991441
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
44991397 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 44991441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 50508575 - 50508615
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| ||||||||||||||||||||  |||||||||||||    
50508575 tgttagttttattcaaataaacgttagggtttgtgttatgt 50508615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 53751020 - 53751060
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| ||||||||||||||||||||  |||||||||||||    
53751020 tgttagttttattcaaataaacgttagggtttgtgttatgt 53751060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 4e-28; HSPs: 39)
Name: chr2

Target: chr2; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 26182032 - 26181958
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
26182032 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26181958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 34735675 - 34735601
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
34735675 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 34735601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 2148218 - 2148144
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||    
2148218 tgttagttttattcaaataaacgttagagtttctgttatgtgggtcctctaactttatttattagtatcattttg 2148144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 8174217 - 8174143
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
8174217 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8174143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 10991969 - 10992043
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
10991969 tgttagttttattcaaataaacgttacagtttgtgttatgtgggtcctctaactttatttattagcatcattttg 10992043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 13193106 - 13193180
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||    
13193106 tgttagttttattcaaataaacgttagagtttgtgttatgttggtcctctaactttatttattagtatcattttg 13193180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 16305143 - 16305217
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
16305143 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 16305217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 24138838 - 24138764
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
24138838 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 24138764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7469284 - 7469358
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| || |||||||||||||    
7469284 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttactagtatcattttg 7469358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12860699 - 12860625
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
12860699 tgttagttttattcaaataaacgttacggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 12860625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 15744575 - 15744649
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
15744575 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 15744649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 19847650 - 19847576
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
19847650 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 19847576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 29472360 - 29472434
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
29472360 tgttagttttattcaaataaacgttaaggtttgtgttatgtgagtcctctaactttatttattagtatcattttg 29472434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 4 - 69
Target Start/End: Original strand, 36713706 - 36713771
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagt 69  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||    
36713706 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagt 36713771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 41474197 - 41474274
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||| ||||||||||||  |||||||||||||||||| ||||||||||| ||||||||||||||||    
41474197 ttatgttagttttatttaaataaacgttagtgtttgtgttatgtgggtcatctaactttatttattagtatcattttg 41474274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 19816030 - 19815962
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||    
19816030 ttttattcaaataaacgttagagtctgtgttatgtgggtcctctgactttatttattagtatcattttg 19815962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 17052175 - 17052250
4 tgttaattttattcaaataaa-cgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
17052175 tgttagttttattcaaataaaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 17052250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 7496311 - 7496237
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||| |||||||||||| |||||| |||||||||    
7496311 tgttagttttattcaaataaacgttagggtttgtgttatgtgggttctctaactttatttattagcatcattttg 7496237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 15406088 - 15406014
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||| ||||||    
15406088 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtattattttg 15406014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 24372299 - 24372225
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||   ||||||||||||||||||||||||||||| ||||||||||||||||    
24372299 tgttagttttattcaaataaacattaggatttgtgttatgtgggtcctctaactttatttattagtatcattttg 24372225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38332822 - 38332896
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
38332822 tgttagttttattcaaataaatgttagggtttgttttatgtgggtcctctaactttatttattagtatcattttg 38332896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 4 - 61
Target Start/End: Complemental strand, 33470255 - 33470198
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttat 61  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||||||||||||    
33470255 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttat 33470198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 2148004 - 2148048
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
2148004 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 2148048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 10992183 - 10992139
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
10992183 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 10992139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 15405874 - 15405918
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
15405874 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 15405918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7469501 - 7469458
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    |||||||| ||||||||||||||||||||| |||||||||||||    
7469501 ttatgttagttttattcaaataaacgttatggtttgtgttatgt 7469458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 13193314 - 13193276
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
13193314 ttttattcaaataaacgttagagtttgtgttatgtgggt 13193276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 36713911 - 36713873
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
36713911 ttttattcaaataaacgttagagtttgtgttatgtgggt 36713873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 41474414 - 41474373
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
41474414 tgttagttttattcaaataaacgttagagtttgtgttatgtg 41474373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 7496098 - 7496142
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
7496098 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 7496142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 8174003 - 8174047
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||| |||||||  |||||||||||||||||    
8174003 tgttaattttattcaaatgaacgttagggtttgtgttatgtgggt 8174047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 34735467 - 34735505
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
34735467 ttttattcaaataaacgttagggtttgtgttatgtgggt 34735505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 46
Target Start/End: Original strand, 42834540 - 42834582
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    ||||| ||||||||||||||||||||  |||||||||||||||    
42834540 tgttagttttattcaaataaacgttagggtttgtgttatgtgg 42834582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 19815822 - 19815863
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
19815822 tgttagttttattcaaataaacgttatgatttgtgttatgtg 19815863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 29472574 - 29472533
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
29472574 tgttagttttattcaaataaacgttagggtttgtgttatgtg 29472533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12860498 - 12860542
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
12860498 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 12860542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 16305357 - 16305313
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||  ||||| |||||||||||||||||    
16305357 tgttagttttattcaaataagagttatggtttgtgttatgtgggt 16305313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 17052386 - 17052342
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||| ||||||||||||||||  |||||||||||||||||    
17052386 tgttagtttcattcaaataaacgttagtgtttgtgttatgtgggt 17052342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 24372085 - 24372129
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
24372085 tgttagttttattcaaataaacgttagggtttgtattatgtgggt 24372129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 4e-28; HSPs: 50)
Name: chr1

Target: chr1; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45053021 - 45052947
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
45053021 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 45052947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 1763006 - 1762932
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
1763006 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 1762932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 2064543 - 2064469
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
2064543 tgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctctaactttatttattagtatcattttg 2064469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 9006523 - 9006449
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||    
9006523 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagtatcattttg 9006449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 38127827 - 38127901
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||    
38127827 tgttagttttattcaaataaacgttatggtttgttttatgtgggtcctctaactttatttattagtatcattttg 38127901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 49140475 - 49140401
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
49140475 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 49140401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 27400756 - 27400683
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||||||||||||    
27400756 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcatttt 27400683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12127385 - 12127311
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
12127385 tgttagttttgttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 12127311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 12481391 - 12481317
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
12481391 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 12481317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 23476673 - 23476599
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||||    
23476673 tgttagttttattcaaataaacgttaatgtttgtgttatgtgagtcctctaactttatttattagtatcattttg 23476599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 37304146 - 37304220
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||| ||||||||||||||||| ||||||||||||||||    
37304146 tgttagttttattcaaataaacgttagggtttgtgttatgagggtcctctaactttatttattagtatcattttg 37304220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 37576299 - 37576373
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||| ||||||||||||    
37576299 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttataagtatcattttg 37576373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 6798142 - 6798065
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||| ||||||||||| ||||| ||||||||||||||||    
6798142 ttatgttagttttattcaaataaacgttagggtttgtgttatgagggtcctctaattttatttattagtatcattttg 6798065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 37285063 - 37284986
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||| ||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
37285063 ttatgttagttttatttaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 37284986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 37586028 - 37585951
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||| | ||||||||||||||||||||||| ||||||||| ||||||    
37586028 ttatgttagttttattcaaataaacgttagagtttatattatgtgggtcctctaactttatttattagtattattttg 37585951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 4330163 - 4330096
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||||||||||||||||||  |||||||||||||||||| ||||||||||| |||||||||||||||    
4330163 ttttattcaaataaacgttagggtttgtgttatgtgggtcttctaactttatttattagtatcatttt 4330096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 12 - 78
Target Start/End: Original strand, 16024023 - 16024089
12 ttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||  |||||||||||| ||||||||||||||||| ||||||||||||||||    
16024023 ttattcaaataaacgttagggtttgtgttatgagggtcctctaactttatttattagtatcattttg 16024089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 27548001 - 27547927
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||| || |||||||||||||||||||||| ||||||||||||||||    
27548001 tgttagttttattcaaataaacgttagggtttatggtatgtgggtcctctaactttatttattagtatcattttg 27547927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31703732 - 31703806
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   |||||||||||||||||||||||||||||| |||||| |||||||||    
31703732 tgttagttttattcaaataaacgttggggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 31703806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 35612414 - 35612340
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  || |||||||||| |||||||||||||||| ||||||||||||||||    
35612414 tgttagttttattcaaataaacgttagggtctgtgttatgttggtcctctaactttatttattagtatcattttg 35612340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 45843449 - 45843375
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||||| |||| | ||||||||||||||||    
45843449 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctagctttttttattagtatcattttg 45843375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 49644002 - 49643929
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||| |||||||||||| ||||||||||||||||    
49644002 tgttagttttattcaaataaacgttag-gtttgtgttatgtgggttctctaactttatttattagtatcattttg 49643929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 20306126 - 20306194
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||   ||||||||||||| ||||||||||||||| ||||||||||||||||    
20306126 ttttattcaaataaacgttaggatttgtgttatgtgagtcctctaactttatttattagtatcattttg 20306194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 8762724 - 8762657
11 tttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||    |||||||||||||||||||||||||||| ||||||||||||||||    
8762724 tttattcaaataaacgttaagagttgtgttatgtgggtcctctaactttatttattagtatcattttg 8762657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 3089460 - 3089534
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||| ||||||||||||||||  ||||||||||||||| |||| ||||||||| ||||||||||||||||    
3089460 tgttagtttaattcaaataaacgttagggtttgtgttatgtggatcctataactttatttattagtatcattttg 3089534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 25995902 - 25995976
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||    |||||||||||||| |||||||||||||| ||||||||||||||||    
25995902 tgttagttttattcaaataaacgttgagatttgtgttatgtggatcctctaactttatttattagtatcattttg 25995976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 39486523 - 39486451
5 gttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||| ||||||||||| ||||||||  ||||||||||| |||||||||||||||||| ||||||||||||||||    
39486523 gttagttttattcaaa-aaacgttagggtttgtgttatatgggtcctctaactttatttattagtatcattttg 39486451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 37304363 - 37304316
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||    
37304363 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggt 37304316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 49140267 - 49140305
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
49140267 ttttattcaaataaacgttagagtttgtgttatgtgggt 49140305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 78
Target Start/End: Complemental strand, 26707491 - 26707454
41 atgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| ||||||||||||||||    
26707491 atgtgggtcctctaactttatttattagtatcattttg 26707454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 4697000 - 4697044
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||| |||||||||||||||| ||||||||||||||||||    
4697000 tgttagtttaattcaaataaacgttagagtttgtgttatgtgggt 4697044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 6797925 - 6797969
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||| ||||||||||||||| ||||||||||||||||||    
6797925 tgttagttttgttcaaataaacgttagagtttgtgttatgtgggt 6797969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 9006309 - 9006353
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
9006309 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 9006353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 25996116 - 25996072
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
25996116 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 25996072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 26707314 - 26707358
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||  ||||||||||||||||||    
26707314 tgttagttttattcaaataaacgttggagtttgtgttatgtgggt 26707358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 37585811 - 37585851
4 tgttaattttattcaaataaacgttatagtttgtgttatgt 44  Q
    ||||| |||||||||||||||||||| ||||||||||||||    
37585811 tgttagttttattcaaataaacgttagagtttgtgttatgt 37585851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 39486320 - 39486364
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| || ||||||||||||||||| ||||||||||||||||||    
39486320 tgttagttctattcaaataaacgttagagtttgtgttatgtgggt 39486364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 78
Target Start/End: Original strand, 44322816 - 44322852
42 tgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||    
44322816 tgtgggtcctctaactttatttattagtatcattttg 44322852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 20306328 - 20306290
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
20306328 ttttattcaaataaacgttagggtttgtgttatgtgggt 20306290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 12127175 - 12127216
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||||  |||||||||||||    
12127175 tgttagttttattcaaataaacgttatgatttgtgttatgtg 12127216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 4697172 - 4697140
46 ggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||| ||||||||||||||||    
4697172 ggtcctctaactttatttattagtatcattttg 4697140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 12481177 - 12481221
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
12481177 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 12481221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 23476459 - 23476503
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | | ||||||||||||||    
23476459 tgttagttttattcaaataaacgttagaatctgtgttatgtgggt 23476503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 37576513 - 37576469
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
37576513 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 37576469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 42
Target Start/End: Original strand, 38000613 - 38000645
10 ttttattcaaataaacgttatagtttgtgttat 42  Q
    |||||||||||||||||||| ||||||||||||    
38000613 ttttattcaaataaacgttagagtttgtgttat 38000645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 44322992 - 44322948
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||    
44322992 tgttagttttattcaaataaatgttagggtttgtgttatgtgggt 44322948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 49643789 - 49643833
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||| |||  |||||||||||||||||    
49643789 tgttagttttattcaaataaacattagggtttgtgttatgtgggt 49643833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1762789 - 1762836
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||| |||  |||||| ||||||||||    
1762789 ttatgttagttttattcaaataaacattagggtttgtattatgtgggt 1762836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8760387 - 8760434
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||  ||||||||||||||| |||  |||||||||||||||||    
8760387 ttatgttagctttattcaaataaacattagggtttgtgttatgtgggt 8760434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 35612206 - 35612241
10 ttttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||||||||||||||||||  ||||||||||||||    
35612206 ttttattcaaataaacgttagggtttgtgttatgtg 35612241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 44)
Name: chr6

Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 18053071 - 18053148
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
18053071 ttatgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 18053148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 3423502 - 3423428
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||    
3423502 tgttagttttattcaaataaacgttagagtttgtgatatgtgggtcctctaactttatttattagtatcattttg 3423428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5938145 - 5938071
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
5938145 tgttagttttattcaaataaacgttaaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 5938071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 7270747 - 7270821
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
7270747 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7270821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24744446 - 24744520
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
24744446 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 24744520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 26600475 - 26600549
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
26600475 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 26600549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 34890762 - 34890836
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
34890762 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 34890836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 5310944 - 5311018
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
5310944 tgttagttttattcaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 5311018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5639505 - 5639431
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||| |||| ||||||||||||||||| |||||||||||| ||||||||||||||||    
5639505 tgttagttttattcaaataaacattatggtttgtgttatgtgggttctctaactttatttattagtatcattttg 5639431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 9046204 - 9046278
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||||||||||||||||||||| ||||| ||||||||||||||||    
9046204 tgttagttttattcaaataaatgttagagtttgtgttatgtgggtcctctaaatttatttattagtatcattttg 9046278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21540309 - 21540235
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||| |||||||||||||||||||||||| ||||||||||||||||    
21540309 tgttagttttattcaaataaacgttagggtttgcgttatgtgggtcctctaactttatttattagtatcattttg 21540235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31247234 - 31247308
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||| ||||||||||||||| ||||||||||||||||    
31247234 tgttagttttattcaaataaacgttagagtttgttttatgtgagtcctctaactttatttattagtatcattttg 31247308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 32993347 - 32993273
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||||||||||||||| ||||||||||||||||    
32993347 tgttagttttattcaaataaacgttagggtttgtattatgtgggtcctctaactttatttattagtatcattttg 32993273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 26957077 - 26957154
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||||||||| ||||| ||||||| |||||||||| |||||| ||||||||||||||||    
26957077 ttatgttagttttattcaaataaacgttaaagtttatgttatgggggtcctctagctttatttattagtatcattttg 26957154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 34994715 - 34994638
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| ||||||||||||||||||||  |||||||||||| |||||||||||||| || ||||||||||||||||    
34994715 ttatgttagttttattcaaataaacgttagggtttgtgttatgcgggtcctctaacttgatttattagtatcattttg 34994638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 35167824 - 35167751
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||| |||||||||  |||||||||||||||||||||||||||||| |||||||||||||||    
35167824 tgttagttttattcaagtaaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcatttt 35167751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 6532310 - 6532377
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtat 71  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||||||    
6532310 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtat 6532377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 6137709 - 6137636
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| | ||||||||||||||||||||||||||||| ||||||||||||||||    
6137709 tgttagttttattcaaataaa-gttagattttgtgttatgtgggtcctctaactttatttattagtatcattttg 6137636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 21856887 - 21856813
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||| |||| |||||| |||||||||||||||||| |||||| |||||||||    
21856887 tgttagttttattcaaataaacgttatggtttttgttatatgggtcctctaactttatttattagcatcattttg 21856813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 25176989 - 25176915
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||| ||||||||||||| |||||| |||||||||    
25176989 tgttagttttattcaaataaacgttagggtttgtgttatgtggggcctctaactttatttattagcatcattttg 25176915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 31237864 - 31237938
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||    
31237864 tgttagttttattcaaataaatgttagagtttgttttatgtgggtcctctaactttatttattagtattattttg 31237938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 7270077 - 7270145
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||| ||||||| ||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
7270077 ttttatttaaataaatgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 7270145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 2517120 - 2517194
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  ||||||||||||||||||||| |||||||| ||| || |||||||||    
2517120 tgttagttttattcaaataaacgttagtgtttgtgttatgtgggtcctccaactttatttataagaatcattttg 2517194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 32753295 - 32753362
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtat 71  Q
    ||||| ||||||||||||||| ||||  |||||||||||||||||||||||||| ||| |||||||||    
32753295 tgttagttttattcaaataaatgttaaggtttgtgttatgtgggtcctctaactgtatttattagtat 32753362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 6236253 - 6236183
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||  ||||||||||||||  ||||||||||| || ||||||||||||    
6236253 tgttagttttattcaaataaacgttagggtttgtgttatgtgaatcctctaacttcatttattagtatcat 6236183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 5311161 - 5311114
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||||    
5311161 ttatgttagttttattcaaataaacgttagagtttgtgttatgtgggt 5311114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 7270285 - 7270241
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||||||||| |||||||| |||||||||    
7270285 tgttaattttattcaaataaacgttagagtttgtggtatgtgggt 7270241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 31238078 - 31238034
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
31238078 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 31238034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 31247448 - 31247404
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
31247448 tgttagttttattcaaataaacgttaaagtttgtgttatgtgggt 31247404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 978533 - 978577
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
978533 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 978577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 5937931 - 5937975
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
5937931 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 5937975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 6236039 - 6236083
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
6236039 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 6236083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 21856673 - 21856717
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
21856673 tgttagttttattcaaataaacgttagagtttgtgttatatgggt 21856717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 26600679 - 26600635
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
26600679 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 26600635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 32753505 - 32753461
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||| | ||||||||||||||||||    
32753505 tgttagttttattcaaataaacgtcagagtttgtgttatgtgggt 32753461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 34994498 - 34994542
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| | ||||||||||||||||    
34994498 tgttagttttattcaaataaacgttagaatttgtgttatgtgggt 34994542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 35167608 - 35167652
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
35167608 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 35167652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 3423294 - 3423332
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
3423294 ttttattcaaataaacgttagggtttgtgttatgtgggt 3423332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 5639297 - 5639335
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||| |||| ||||||||||||||||||    
5639297 ttttattcaaataaatgttagagtttgtgttatgtgggt 5639335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 24744647 - 24744609
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||  |||||||||||||||||    
24744647 ttttattcaaataaacgttagggtttgtgttatgtgggt 24744609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 9046418 - 9046374
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| || |||||||||||||||||  |||||||||||||||||    
9046418 tgttagttctattcaaataaacgttagggtttgtgttatgtgggt 9046374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 15932888 - 15932844
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
15932888 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 15932844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 34890976 - 34890932
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||   ||||||||||||||||    
34890976 tgttagttttattcaaataaacgttaggatttgtgttatgtgggt 34890932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 41
Target Start/End: Complemental strand, 10412831 - 10412796
6 ttaattttattcaaataaacgttatagtttgtgtta 41  Q
    ||||||||||||||||||||||||  ||||||||||    
10412831 ttaattttattcaaataaacgttagggtttgtgtta 10412796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0220 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: scaffold0220

Target: scaffold0220; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 20869 - 20943
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||    
20869 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattagcatcattttg 20943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: scaffold0032

Target: scaffold0032; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 82190 - 82116
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||    
82190 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattaatatcattttg 82116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: scaffold0019

Target: scaffold0019; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 50808 - 50734
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
50808 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 50734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 50594 - 50638
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
50594 tgttatttttattcaaataaacgttagggtttgtgttatgtgggt 50638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 59; Significance: 1e-25; HSPs: 4)
Name: scaffold0003

Target: scaffold0003; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 349191 - 349265
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||    
349191 tgttagttttattcaaataaacgttagagtttgcgttatgtgggtcctctaactttatttattagtatcattttg 349265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 349405 - 349361
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||||||||||||||||||| ||||  |||||||||||||||||    
349405 tgttaattttattcaaataaatgttagggtttgtgttatgtgggt 349361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #3
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 78
Target Start/End: Original strand, 113519 - 113558
39 ttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||| |||||||||||||| ||||||||||||||||    
113519 ttatgtggctcctctaactttatttattagtatcattttg 113558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #4
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 113698 - 113654
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||| |||||||||||||    
113698 tgttagttttattcaaataaacgttaaggttagtgttatgtgggt 113654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 59; Significance: 1e-25; HSPs: 23)
Name: chr5

Target: chr5; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 9989441 - 9989515
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
9989441 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 9989515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2183058 - 2183135
1 ttatgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||  |||||||||||||||||||  |||||||||||||||||||||||||||||| ||||||||||||||||    
2183058 ttatgttagctttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 2183135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 34264674 - 34264606
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||    
34264674 ttttattcaaataaacgttagagtttgtgttatgtgggtcctctaactttatttattaatatcattttg 34264606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 4 - 76
Target Start/End: Complemental strand, 35570112 - 35570040
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattt 76  Q
    ||||| ||||||||||||||||||||  |||||||||||||| ||||||||||||||| ||||||||||||||    
35570112 tgttagttttattcaaataaacgttagggtttgtgttatgtgagtcctctaactttatttattagtatcattt 35570040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 11316076 - 11316150
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||| |||||||||||  ||||||||||||| |||||||||||||||| ||||||||||||||||    
11316076 tgttagttttattccaataaacgttagggtttgtgttatgtaggtcctctaactttatttattagtatcattttg 11316150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 74
Target Start/End: Complemental strand, 24040419 - 24040349
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcat 74  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||| ||||||||||| ||||||||||||    
24040419 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcttctaactttatttattagtatcat 24040349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 36440532 - 36440458
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   ||||||||||| |||||||||||||||||| ||||||||||||||||    
36440532 tgttagttttattcaaataaacgttggggtttgtgttatatgggtcctctaactttatttattagtatcattttg 36440458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 4 - 77
Target Start/End: Complemental strand, 25567320 - 25567247
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||| |||||||||||||||||||| ||||| ||||||||| ||||||||||||||| ||||||||| |||||    
25567320 tgttagttttattcaaataaacgttagagtttttgttatgtgagtcctctaactttatttattagtattatttt 25567247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 37424597 - 37424520
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt---cctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||   ||||||||||||| ||||| ||||||||||    
37424597 tgttagttttattcaaataaacgttagagtttgtgttatgtgggtcctcctctaactttatttattaatatcattttg 37424520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 32288408 - 32288335
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||  |||| ||||||||||||||||||||||||||||||| ||||||||| ||||||    
32288408 tgttagttttattcaaataat-gttagagtttgtgttatgtgggtcctctaactttatttattagtattattttg 32288335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 38959055 - 38958982
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||||||||| |||| | ||||||||||||| ||||||||||||||| ||| ||||||||||||    
38959055 tgttaattttattcaaataaa-gttagattttgtgttatgtgagtcctctaactttatttataagtatcattttg 38958982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 27185997 - 27186065
10 ttttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||||||||||||| ||||  |||||| ||||||||||||||||| |||||  |||||||||||||||    
27185997 ttttattcaaataaatgttagggtttgttttatgtgggtcctctaattttattaattagtatcattttg 27186065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 9989655 - 9989611
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
9989655 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 9989611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 36440318 - 36440362
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
36440318 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 36440362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 55
Target Start/End: Complemental strand, 39325687 - 39325636
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaa 55  Q
    ||||| ||||||||||||||||||||  ||||||||||||||| ||||||||    
39325687 tgttagttttattcaaataaacgttagggtttgtgttatgtggctcctctaa 39325636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 48
Target Start/End: Original strand, 24040209 - 24040247
10 ttttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    |||||||||||||||||||| ||||||||||||||||||    
24040209 ttttattcaaataaacgttagagtttgtgttatgtgggt 24040247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 16860421 - 16860462
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
16860421 tgttagttttattcaaataaacgttagagtttgtgttatgtg 16860462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 25182985 - 25182941
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
25182985 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 25182941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 37424380 - 37424424
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||    
37424380 tgttagttttattcaaataaacgttagagtttgtgttatttgggt 37424424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 35569893 - 35569934
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| ||||||||||||||||||||  ||||||||||||||    
35569893 tgttagttttattcaaataaacgttagggtttgtgttatgtg 35569934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 6 - 46
Target Start/End: Complemental strand, 11316284 - 11316244
6 ttaattttattcaaataaacgttatagtttgtgttatgtgg 46  Q
    |||||||||||| |||||||||||  |||||||||||||||    
11316284 ttaattttattcgaataaacgttagggtttgtgttatgtgg 11316244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 27186205 - 27186161
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
27186205 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 27186161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 47
Target Start/End: Original strand, 39325530 - 39325573
4 tgttaattttattcaaataaacgttatagtttgtgttatgtggg 47  Q
    ||||| ||||||||||||||||||||  |||| |||||||||||    
39325530 tgttagttttattcaaataaacgttagggtttctgttatgtggg 39325573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0340

Target: scaffold0340; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 18391 - 18465
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||| ||||| ||||||||||||||||    
18391 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaattttatttattagtatcattttg 18465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 18605 - 18561
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
18605 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 18561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0221

Target: scaffold0221; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 8546 - 8620
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||   |||||||||||||||||||||||||||||| ||||||||||||||||    
8546 tgttagttttattcaaataaacgttgaggtttgtgttatgtgggtcctctaactttatttattagtatcattttg 8620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 8760 - 8716
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||| ||||    
8760 tgttagttttattcaaataaacgttagggtttgtgttatgcgggt 8716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0182

Target: scaffold0182; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 19826 - 19900
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |||||||||    
19826 tgttagttttattcaaataaacgttagagtttgtattatgtgggtcctctaactttatttattagcatcattttg 19900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0182; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 20040 - 19996
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  ||||||||||| |||||    
20040 tgttagttttattcaaataaacgttagggtttgtgttatatgggt 19996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0134 (Bit Score: 55; Significance: 3e-23; HSPs: 2)
Name: scaffold0134

Target: scaffold0134; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 14467 - 14393
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||| |||||||||    
14467 tgttagttttattcaaataaacgttagagtttgtgttatctgggtcctctaactttatttattagcatcattttg 14393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0134; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 14253 - 14297
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
14253 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 14297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: scaffold0029

Target: scaffold0029; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 72880 - 72954
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||| |||||| |||||||||    
72880 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattagcatcattttg 72954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037 (Bit Score: 51; Significance: 6e-21; HSPs: 3)
Name: scaffold0037

Target: scaffold0037; HSP #1
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 45874 - 45948
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||||||||||||||  ||||||| ||||||||    
45874 tgttagttttattcaaataaacgttagggtttgtgttatgtgggtcctctaactttacttattagtttcattttg 45948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037; HSP #2
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 56468 - 56424
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
56468 tgttagttttattcaaataaacgttagggtttgttttatgtgggt 56424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037; HSP #3
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 63593 - 63549
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||| ||||||||||    
63593 tgttagttttattcaaataaacgttagggtttgttttatgtgggt 63549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 48; Significance: 4e-19; HSPs: 2)
Name: scaffold0072

Target: scaffold0072; HSP #1
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 14 - 77
Target Start/End: Original strand, 15576 - 15639
14 attcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcatttt 77  Q
    ||||||||||| |||  ||||||||||||||||||||||||||||||| |||||||||||||||    
15576 attcaaataaatgtttgagtttgtgttatgtgggtcctctaactttatttattagtatcatttt 15639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072; HSP #2
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 15780 - 15736
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| ||||||||||||||||||||  |||||||||||||||||    
15780 tgttagttttattcaaataaacgttagggtttgtgttatgtgggt 15736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0186 (Bit Score: 47; Significance: 2e-18; HSPs: 2)
Name: scaffold0186

Target: scaffold0186; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 24280 - 24354
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| |||| |||||||||||||||  |||||||||||||||||||||||||||||| |||||  |||||||||    
24280 tgttagtttttttcaaataaacgttagggtttgtgttatgtgggtcctctaactttatttattaacatcattttg 24354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0186; HSP #2
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 4 - 42
Target Start/End: Complemental strand, 24494 - 24456
4 tgttaattttattcaaataaacgttatagtttgtgttat 42  Q
    ||||||||||||||||||||||||||  |||||||||||    
24494 tgttaattttattcaaataaacgttagggtttgtgttat 24456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0115 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: scaffold0115

Target: scaffold0115; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 21630 - 21703
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtattagtatcattttg 78  Q
    ||||| ||||||||||||||| ||||   ||||||||||||||||||||||||||||| ||||||||||||||||    
21630 tgttagttttattcaaataaa-gttaggttttgtgttatgtgggtcctctaactttatttattagtatcattttg 21703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246 (Bit Score: 44; Significance: 1e-16; HSPs: 2)
Name: scaffold0246

Target: scaffold0246; HSP #1
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 6116 - 6179
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggtcctctaactttatgtatta 67  Q
    ||||| |||||||||||||||| ||| |||||||||||||||| |||||||||||||| |||||    
6116 tgttagttttattcaaataaacattagagtttgtgttatgtggatcctctaactttatttatta 6179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246; HSP #2
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 6327 - 6283
4 tgttaattttattcaaataaacgttatagtttgtgttatgtgggt 48  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||    
6327 tgttagttttattcaaataaacgttagagtttgtgttatgtgggt 6283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 34; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0260

Target: scaffold0260; HSP #1
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 14309 - 14350
4 tgttaattttattcaaataaacgttatagtttgtgttatgtg 45  Q
    ||||| |||||||||||||||||||| |||||||||||||||    
14309 tgttagttttattcaaataaacgttagagtttgtgttatgtg 14350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC