View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-25 (Length: 47)

Name: NF0440-3-1-Insertion-25
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-25
[»] chr6 (1 HSPs)
chr6 (1-47)||(27970481-27970527)

Alignment Details
Target: chr6 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 27970481 - 27970527
1 tttgagagcaaatgaagggtaatttaagtcccttgcaatcgcatatc 47  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||    
27970481 tttgagagcaaatgaagggtaatttaagtcccttgcagtcgcatatc 27970527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98591 times since January 2019
Visitors: 2275