View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-27 (Length: 27)

Name: NF0440-3-1-Insertion-27
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-27
[»] chr2 (1 HSPs)
chr2 (1-27)||(42964104-42964130)

Alignment Details
Target: chr2 (Bit Score: 27; Significance: 0.0000002; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 27; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 27
Target Start/End: Original strand, 42964104 - 42964130
1 atttataataagacatgttttcaattt 27  Q
42964104 atttataataagacatgttttcaattt 42964130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC