View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-38 (Length: 158)

Name: NF0440-3-1-Insertion-38
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-38
[»] chr4 (3 HSPs)
chr4 (6-158)||(44919715-44919867)
chr4 (90-158)||(7411664-7411732)
chr4 (91-158)||(7457744-7457811)
[»] scaffold1330 (1 HSPs)
scaffold1330 (90-158)||(1394-1462)
[»] scaffold0345 (1 HSPs)
scaffold0345 (90-158)||(3916-3984)
[»] scaffold0105 (4 HSPs)
scaffold0105 (90-158)||(4029-4097)
scaffold0105 (90-158)||(10111-10179)
scaffold0105 (90-158)||(34995-35063)
scaffold0105 (90-158)||(48595-48663)
[»] scaffold0496 (1 HSPs)
scaffold0496 (90-158)||(2592-2660)
[»] chr8 (1 HSPs)
chr8 (81-158)||(24611194-24611271)

Alignment Details
Target: chr4 (Bit Score: 153; Significance: 2e-81; HSPs: 3)
Name: chr4

Target: chr4; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 6 - 158
Target Start/End: Original strand, 44919715 - 44919867
6 cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat 105  Q
44919715 cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat 44919814  T
106 gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
44919815 gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 44919867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 7411664 - 7411732
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| |||||||||    
7411664 atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt 7411732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 91 - 158
Target Start/End: Original strand, 7457744 - 7457811
91 tgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    |||||||||| ||||||| ||| |||||  ||||||| |||||||||||||||||||| |||||||||    
7457744 tgaatactccaagatgctcgttcggttcatccagccttggagaaattgcaatattagcaggtggttgt 7457811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1330 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold1330

Target: scaffold1330; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 1394 - 1462
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
1394 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 1462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0345 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold0345

Target: scaffold0345; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 3984 - 3916
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
3984 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 3916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 45; Significance: 6e-17; HSPs: 4)
Name: scaffold0105

Target: scaffold0105; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 4097 - 4029
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
4097 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 4029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 10179 - 10111
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
10179 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 10111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #3
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 34995 - 35063
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
34995 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 35063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #4
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 48595 - 48663
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
48595 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 48663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0496

Target: scaffold0496; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 2592 - 2660
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| |||||||||    
2592 atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt 2660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 81 - 158
Target Start/End: Original strand, 24611194 - 24611271
81 ggaatgaaaatgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    |||||||  ||||||  ||| |||||||||||||||||||| |||||| |||| ||||| ||  |||| |||||||||    
24611194 ggaatgaggatgaattttccaagatgcttgtttggttctgctagcctcagagagattgcgattctagctggtggttgt 24611271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 78131 times since January 2019
Visitors: 2276