View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-38 (Length: 158)

Name: NF0440-3-1-Insertion-38
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-38
NF0440-3-1-Insertion-38
[»] chr4 (3 HSPs)
chr4 (6-158)||(44919715-44919867)
chr4 (90-158)||(7411664-7411732)
chr4 (91-158)||(7457744-7457811)
[»] scaffold1330 (1 HSPs)
scaffold1330 (90-158)||(1394-1462)
[»] scaffold0345 (1 HSPs)
scaffold0345 (90-158)||(3916-3984)
[»] scaffold0105 (4 HSPs)
scaffold0105 (90-158)||(4029-4097)
scaffold0105 (90-158)||(10111-10179)
scaffold0105 (90-158)||(34995-35063)
scaffold0105 (90-158)||(48595-48663)
[»] scaffold0496 (1 HSPs)
scaffold0496 (90-158)||(2592-2660)
[»] chr8 (1 HSPs)
chr8 (81-158)||(24611194-24611271)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 2e-81; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 6 - 158
Target Start/End: Original strand, 44919715 - 44919867
Alignment:
6 cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44919715 cttcttgtttttggaagagaaataactggccttgccatatataagtatagcattctgacaaattcatggttgaagggaatgaaaatgaatactcctagat 44919814  T
106 gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
44919815 gcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 44919867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 7411664 - 7411732
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| |||||||||    
7411664 atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt 7411732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000006
Query Start/End: Original strand, 91 - 158
Target Start/End: Original strand, 7457744 - 7457811
Alignment:
91 tgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    |||||||||| ||||||| ||| |||||  ||||||| |||||||||||||||||||| |||||||||    
7457744 tgaatactccaagatgctcgttcggttcatccagccttggagaaattgcaatattagcaggtggttgt 7457811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1330 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold1330
Description:

Target: scaffold1330; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 1394 - 1462
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
1394 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 1462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0345 (Bit Score: 45; Significance: 6e-17; HSPs: 1)
Name: scaffold0345
Description:

Target: scaffold0345; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 3984 - 3916
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
3984 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 3916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 45; Significance: 6e-17; HSPs: 4)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 4097 - 4029
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
4097 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 4029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #2
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Complemental strand, 10179 - 10111
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
10179 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 10111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #3
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 34995 - 35063
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
34995 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 35063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105; HSP #4
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 48595 - 48663
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| ||||||||||||||    
48595 atgaatactccgagatgcttgtttggttcggctagtcttggagaaattgcaatactagccggtggttgt 48663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 158
Target Start/End: Original strand, 2592 - 2660
Alignment:
90 atgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    ||||||||||| ||||||||||||||||| || || || ||||||||||||||| |||| |||||||||    
2592 atgaatactccaagatgcttgtttggttcggctagtcttggagaaattgcaatactagctggtggttgt 2660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 81 - 158
Target Start/End: Original strand, 24611194 - 24611271
Alignment:
81 ggaatgaaaatgaatactcctagatgcttgtttggttctgccagcctcggagaaattgcaatattagccggtggttgt 158  Q
    |||||||  ||||||  ||| |||||||||||||||||||| |||||| |||| ||||| ||  |||| |||||||||    
24611194 ggaatgaggatgaattttccaagatgcttgtttggttctgctagcctcagagagattgcgattctagctggtggttgt 24611271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC