View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-39 (Length: 150)

Name: NF0440-3-1-Insertion-39
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-39
[»] chr4 (1 HSPs)
chr4 (7-150)||(41485135-41485278)

Alignment Details
Target: chr4 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 41485135 - 41485278
7 ctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcattaccttcagagtagtt 106  Q
41485135 ctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgttttagcattaccttcagagtagtt 41485234  T
107 tatccaaatgtctgttcagagttgttttgttttccaaacaagta 150  Q
41485235 tatccaaatgtctgttcagagttgttttgttttccaaacaagta 41485278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC