View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-4 (Length: 251)

Name: NF0440-3-1-Insertion-4
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-4
[»] chr5 (1 HSPs)
chr5 (1-251)||(39578531-39578781)

Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 39578781 - 39578531
1 tcaacctccaaacttaaaccataaggatgaattaatgaagccacctatagatgcgtatataggaaaaccttcaacctctgctcataagaaaagtttgggg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
39578781 tcaacctccaaacttaaaccataaggatgaattaatgaagccacctatagatgcgtatataggagaaccttcaacctctgctcataagaaaagtttgggg 39578682  T
101 acacaaagtacaagaaatattgatgaaaatattcttgtttggaatgaggtcaggactttgtgaagcacaaagtagctttccttctgtagatatagacaca 200  Q
39578681 acacaaagtacaagaaatattgatgaaaatattcttgtttggaatgaggtcaggactttgtgaagcacaaagtagctttccttctgtagatatagacaca 39578582  T
201 accatgcttgctgcttttacaagaggtaaatgggttacattttcattccta 251  Q
39578581 accatgcttgctgcttttacaagaggtaaatgggttacattttcattccta 39578531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC