View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-4 (Length: 251)

Name: NF0440-3-1-Insertion-4
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-4
NF0440-3-1-Insertion-4
[»] chr5 (1 HSPs)
chr5 (1-251)||(39578531-39578781)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 39578781 - 39578531
Alignment:
1 tcaacctccaaacttaaaccataaggatgaattaatgaagccacctatagatgcgtatataggaaaaccttcaacctctgctcataagaaaagtttgggg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
39578781 tcaacctccaaacttaaaccataaggatgaattaatgaagccacctatagatgcgtatataggagaaccttcaacctctgctcataagaaaagtttgggg 39578682  T
101 acacaaagtacaagaaatattgatgaaaatattcttgtttggaatgaggtcaggactttgtgaagcacaaagtagctttccttctgtagatatagacaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39578681 acacaaagtacaagaaatattgatgaaaatattcttgtttggaatgaggtcaggactttgtgaagcacaaagtagctttccttctgtagatatagacaca 39578582  T
201 accatgcttgctgcttttacaagaggtaaatgggttacattttcattccta 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
39578581 accatgcttgctgcttttacaagaggtaaatgggttacattttcattccta 39578531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84070 times since January 2019
Visitors: 2323