View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-40 (Length: 101)

Name: NF0440-3-1-Insertion-40
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-40
[»] chr4 (1 HSPs)
chr4 (2-101)||(3482851-3482951)

Alignment Details
Target: chr4 (Bit Score: 53; Significance: 6e-22; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 53; E-Value: 6e-22
Query Start/End: Original strand, 2 - 101
Target Start/End: Complemental strand, 3482951 - 3482851
2 tttttgactccagcatcttaacaactgagccatatacaacgattccaatctttaccacatcatcacattatc-aaagcttatgcactcttttgttgaatc 100  Q
    |||||||||||| |||| |||| ||| || |||||||||||| ||||||||  ||||||||||||||||||| ||||||| |||||| ||||||||||||    
3482951 tttttgactccaccatcctaacgacttagtcatatacaacgagtccaatctaaaccacatcatcacattatcaaaagcttctgcacttttttgttgaatc 3482852  T
101 a 101  Q
3482851 a 3482851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77647 times since January 2019
Visitors: 2276