View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-42 (Length: 80)

Name: NF0440-3-1-Insertion-42
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-42
NF0440-3-1-Insertion-42
[»] chr2 (1 HSPs)
chr2 (1-80)||(39028078-39028157)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 39028078 - 39028157
Alignment:
1 gtagaaagccaatgcaaacaggaaatttcacagcctcaaagtaacaacaacaatgtcacttcttctaatgatagaattac 80  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39028078 gtagaaagccaatgcaaacaggaaaattcacagcctcaaagtaacaacaacaatgtcacttcttctaatgatagaattac 39028157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC