View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-43 (Length: 79)

Name: NF0440-3-1-Insertion-43
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-43
[»] chr2 (1 HSPs)
chr2 (6-79)||(43853716-43853793)

Alignment Details
Target: chr2 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 6 - 79
Target Start/End: Complemental strand, 43853793 - 43853716
6 gattttggccctctcataaattccaacatat----cagcctcaaaattggttagaaacttatttaactattgatttag 79  Q
    |||||||||||||||||||||||||||||||    |||||||||||||||| |||||||||||||| |||||||||||    
43853793 gattttggccctctcataaattccaacatatatatcagcctcaaaattggtcagaaacttatttaaatattgatttag 43853716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC