View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-44 (Length: 98)

Name: NF0440-3-1-Insertion-44
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-44
[»] chr3 (30 HSPs)
chr3 (1-95)||(10580163-10580257)
chr3 (1-96)||(10376258-10376353)
chr3 (1-98)||(10088349-10088446)
chr3 (2-98)||(10434458-10434554)
chr3 (1-98)||(10195232-10195329)
chr3 (1-98)||(10364211-10364308)
chr3 (1-98)||(11149267-11149364)
chr3 (10-98)||(8860845-8860933)
chr3 (1-87)||(9838431-9838517)
chr3 (1-87)||(9849309-9849395)
chr3 (1-87)||(10076836-10076922)
chr3 (1-98)||(11768793-11768890)
chr3 (1-90)||(11160430-11160519)
chr3 (1-90)||(11131439-11131528)
chr3 (31-90)||(10888873-10888932)
chr3 (31-88)||(10517057-10517114)
chr3 (31-88)||(10526928-10526985)
chr3 (31-88)||(10541543-10541600)
chr3 (31-88)||(11782422-11782479)
chr3 (30-88)||(10500146-10500204)
chr3 (1-91)||(13160546-13160636)
chr3 (1-91)||(13289231-13289321)
chr3 (1-91)||(13332470-13332560)
chr3 (1-91)||(13170597-13170687)
chr3 (1-91)||(13343655-13343745)
chr3 (30-87)||(10085678-10085735)
chr3 (1-62)||(10126511-10126572)
chr3 (30-87)||(10192598-10192655)
chr3 (1-62)||(10260281-10260342)
chr3 (19-62)||(10031586-10031629)
[»] chr2 (1 HSPs)
chr2 (1-98)||(26906456-26906553)
[»] scaffold0083 (1 HSPs)
scaffold0083 (1-98)||(50218-50315)
[»] chr8 (2 HSPs)
chr8 (1-85)||(11484589-11484673)
chr8 (4-88)||(44958125-44958209)
[»] chr6 (1 HSPs)
chr6 (11-98)||(31680162-31680249)
[»] scaffold0002 (2 HSPs)
scaffold0002 (1-91)||(146352-146442)
scaffold0002 (1-91)||(136301-136391)
[»] chr4 (1 HSPs)
chr4 (46-88)||(17853378-17853420)

Alignment Details
Target: chr3 (Bit Score: 83; Significance: 7e-40; HSPs: 30)
Name: chr3

Target: chr3; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 10580257 - 10580163
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggatt 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||    
10580257 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaatgatagcatctttcaagtcatcaagccatagtttgacagcaggatt 10580163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 10376258 - 10376353
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattg 96  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||    
10376258 catcgcagggaatcataactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcatcaagccattgcttgacagaaggattg 10376353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 70; E-Value: 4e-32
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10088446 - 10088349
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| |||||||| |||||||||||  |||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
10088446 catcgaagggaatcataactgatttcgctgagcaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 10088349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 10434458 - 10434554
2 atcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||| |||||||| ||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||    
10434458 atcgaagggaatcataactgatttcgttgagcaagtcctcggcatcaaagacagcatctttcaagtcatcaagccattgtttgacagcaggtttgtt 10434554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10195329 - 10195232
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| |||||||| |||||||||||  ||| |||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
10195329 catcgaagggaatcataactgatttcgctgaacaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 10195232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 10364211 - 10364308
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| ||||||||||| |  ||||| ||||| |||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||    
10364211 catcgcagggaatcataactgatttcgtgaagcaaatcctcggcatcaaagacagcatctttcaagccatcaagccattgtttgacagcaggattgtt 10364308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11149267 - 11149364
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
11149267 catcgcagtgattcataactaatttgattcagcaaatcctcggcatcaaagatagcatctttcaagtcatcaagccattgtttgacagcaggattgtt 11149364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 61; E-Value: 9e-27
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 8860933 - 8860845
10 gaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| ||||||||||  |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||    
8860933 gaatcataactgatttggttgagcaaatcctcagcatcaaagagagcatctttcaagtcatcaagccattgtttgacagcacgattgtt 8860845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 9838517 - 9838431
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||| | |||||||||||| || |||||| |||||||||    
9838517 catcgcagggaatcgtaactgatttcgttgagcaaatcctcagcatcaaagacaacatctttcaagttatcaagccactgtttgaca 9838431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 9849395 - 9849309
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||| | |||||||||||| || |||||| |||||||||    
9849395 catcgcagggaatcgtaactgatttcgttgagcaaatcctcagcatcaaagacaacatctttcaagttatcaagccactgtttgaca 9849309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 10076922 - 10076836
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||| ||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||| || |||||| ||| |||||    
10076922 catcgcagtgaatcgtaactgatttcgttgagcaagtcctcggcatcaaagacagcatctttcaagttatcaagccactgtctgaca 10076836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 11768890 - 11768793
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| ||||| || ||||| |||| || ||| || |||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||    
11768890 catcggagggagtcataacttatttgatcgagtaaatcctcagcatcaaagatagcgtctttcaagtcatcaagccattgtttgacagcaagattgtt 11768793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 11160430 - 11160519
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||| ||||||||||||||||| |||||||||||||||||||    
11160430 catcgcagtgattcataactaatttgattcagcaaatcctcggcatcaaagacagcatctttcaagtcatcaagccattgtttgacagca 11160519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 8e-18
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 11131439 - 11131528
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||||||||||||||||||||| || ||||| ||||||||||    
11131439 catcgcagtgactcataactaatttgattcagcaaatcctccgcatcaaagatagcatctttcaagtcatcaacccattttttgacagca 11131528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 10888932 - 10888873
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    ||||| ||||| |||||||||| ||||||||||||||||| |||||||||||||||||||    
10888932 agcaaatcctccgcatcaaagacagcatctttcaagtcatcaagccattgtttgacagca 10888873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10517114 - 10517057
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || |||| ||||||||| |||||||||||||||| |||||||||||||||||    
10517114 agcaaatcttcagaatcaaagattgcatctttcaagtcatcaagccattgtttgacag 10517057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10526985 - 10526928
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || ||||||||||| || |||||||||||||||| |||||||||||||||||    
10526985 agcaaatcttcagcatcaaatattgcatctttcaagtcatgaagccattgtttgacag 10526928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10541600 - 10541543
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || |||||||||||||| |||||||||||||||| ||||||||| |||||||    
10541600 agcaaatcttcagcatcaaagattgcatctttcaagtcatcaagccattgcttgacag 10541543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Original strand, 11782422 - 11782479
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || ||||||||||| || |||||||||||||||| |||||||||||||||||    
11782422 agcaaatcttcagcatcaaatattgcatctttcaagtcatcaagccattgtttgacag 11782479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 88
Target Start/End: Complemental strand, 10500204 - 10500146
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    |||||| || |||||||||||||| |  ||||||||||||| |||||||||||||||||    
10500204 gagcaaatcttcagcatcaaagattgtgtctttcaagtcatcaagccattgtttgacag 10500146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13160636 - 13160546
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13160636 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 13160546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13289321 - 13289231
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13289321 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13289231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13332560 - 13332470
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13332560 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13332470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13170687 - 13170597
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||| ||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13170687 catcggagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 13170597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13343745 - 13343655
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||  ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13343745 catcgcagggagtcgtagttgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13343655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 10085735 - 10085678
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||| || ||||||||||||| | |||||||||||| || |||||| |||||||||    
10085735 gagcaaatcttcagcatcaaagaaaacatctttcaagttatcaagccactgtttgaca 10085678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10126572 - 10126511
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||| |||| || ||| ||||||| ||||||||| |||||||||||| |||| ||||||||    
10126572 catcgtagggcattgtagctgatttgattgagcaaatcctcagcatcatagattgcatcttt 10126511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 10192655 - 10192598
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||| || ||||||||||||| | |||||||||||| || |||||| |||||||||    
10192655 gagcaaatcttcagcatcaaagaaaacatctttcaagttatcaagccactgtttgaca 10192598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10260342 - 10260281
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||| |||| || ||| ||||||| ||||||||| |||||||||||| |||| ||||||||    
10260342 catcgtagggcattgtagctgattttattgagcaaatcctcagcatcatagattgcatcttt 10260281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 10031629 - 10031586
19 ctgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||||| ||||||||| |||||||||||| |||| ||||||||    
10031629 ctgatttgattgagcaaatcctcagcatcatagattgcatcttt 10031586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 78; Significance: 7e-37; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 26906553 - 26906456
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| ||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26906553 catcgcagggaatcataactaatttcgttgagcaagtcctcaacatcaaagatagcatctttcaagtcatcaagccattgtttgacagcaggattgtt 26906456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: scaffold0083

Target: scaffold0083; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 50218 - 50315
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| |||||||||||  |||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
50218 catcgcagggaatcataactgatttcgctgagcaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 50315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.000000000000008; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 11484673 - 11484589
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttga 85  Q
    ||||||| || ||| || ||||||||||| ||||| ||||||||||||||||| |||||||||||   || ||||||||||||||    
11484673 catcgcaaggcatcatagctgatttcattaagcaaatcctcagcatcaaagattgcatctttcaaccgatcaagccattgtttga 11484589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 88
Target Start/End: Original strand, 44958125 - 44958209
4 cgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||||||||| || || ||||  |||||||| ||||| |||||||| || | || ||||||||||| |||||||||||||||||    
44958125 cgcagggaatcatagctaatttggttgagcaaatcctcggcatcaaatattgtatttttcaagtcatcaagccattgtttgacag 44958209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.00000000000003; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 98
Target Start/End: Original strand, 31680162 - 31680249
11 aatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||| |||||||| |  |||||||| |||||||||||| | || ||||||||||| |||| ||||||||||||||||| | |||||||    
31680162 aatcataactgatctggttgagcaaatcctcagcatcatatattgcatctttcaactcatcaagccattgtttgacaggaagattgtt 31680249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 35; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0002

Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 146352 - 146442
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
146352 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 146442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 136301 - 136391
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||| ||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
136301 catcggagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 136391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.000000007; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 46 - 88
Target Start/End: Original strand, 17853378 - 17853420
46 tcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||||||||| |||||||| |||| |||||||||||||||||    
17853378 tcaaagatagcgtctttcaaatcatcaagccattgtttgacag 17853420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94962 times since January 2019
Visitors: 2222