View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-44 (Length: 98)

Name: NF0440-3-1-Insertion-44
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-44
NF0440-3-1-Insertion-44
[»] chr3 (30 HSPs)
chr3 (1-95)||(10580163-10580257)
chr3 (1-96)||(10376258-10376353)
chr3 (1-98)||(10088349-10088446)
chr3 (2-98)||(10434458-10434554)
chr3 (1-98)||(10195232-10195329)
chr3 (1-98)||(10364211-10364308)
chr3 (1-98)||(11149267-11149364)
chr3 (10-98)||(8860845-8860933)
chr3 (1-87)||(9838431-9838517)
chr3 (1-87)||(9849309-9849395)
chr3 (1-87)||(10076836-10076922)
chr3 (1-98)||(11768793-11768890)
chr3 (1-90)||(11160430-11160519)
chr3 (1-90)||(11131439-11131528)
chr3 (31-90)||(10888873-10888932)
chr3 (31-88)||(10517057-10517114)
chr3 (31-88)||(10526928-10526985)
chr3 (31-88)||(10541543-10541600)
chr3 (31-88)||(11782422-11782479)
chr3 (30-88)||(10500146-10500204)
chr3 (1-91)||(13160546-13160636)
chr3 (1-91)||(13289231-13289321)
chr3 (1-91)||(13332470-13332560)
chr3 (1-91)||(13170597-13170687)
chr3 (1-91)||(13343655-13343745)
chr3 (30-87)||(10085678-10085735)
chr3 (1-62)||(10126511-10126572)
chr3 (30-87)||(10192598-10192655)
chr3 (1-62)||(10260281-10260342)
chr3 (19-62)||(10031586-10031629)
[»] chr2 (1 HSPs)
chr2 (1-98)||(26906456-26906553)
[»] scaffold0083 (1 HSPs)
scaffold0083 (1-98)||(50218-50315)
[»] chr8 (2 HSPs)
chr8 (1-85)||(11484589-11484673)
chr8 (4-88)||(44958125-44958209)
[»] chr6 (1 HSPs)
chr6 (11-98)||(31680162-31680249)
[»] scaffold0002 (2 HSPs)
scaffold0002 (1-91)||(146352-146442)
scaffold0002 (1-91)||(136301-136391)
[»] chr4 (1 HSPs)
chr4 (46-88)||(17853378-17853420)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 7e-40; HSPs: 30)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 10580257 - 10580163
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggatt 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||    
10580257 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaatgatagcatctttcaagtcatcaagccatagtttgacagcaggatt 10580163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 10376258 - 10376353
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattg 96  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||    
10376258 catcgcagggaatcataactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcatcaagccattgcttgacagaaggattg 10376353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 70; E-Value: 4e-32
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10088446 - 10088349
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| |||||||| |||||||||||  |||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
10088446 catcgaagggaatcataactgatttcgctgagcaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 10088349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 10434458 - 10434554
Alignment:
2 atcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||| |||||||| ||||||||||| |||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||    
10434458 atcgaagggaatcataactgatttcgttgagcaagtcctcggcatcaaagacagcatctttcaagtcatcaagccattgtttgacagcaggtttgtt 10434554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10195329 - 10195232
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| |||||||| |||||||||||  ||| |||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
10195329 catcgaagggaatcataactgatttcgctgaacaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 10195232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 10364211 - 10364308
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| ||||||||||| |  ||||| ||||| |||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||    
10364211 catcgcagggaatcataactgatttcgtgaagcaaatcctcggcatcaaagacagcatctttcaagccatcaagccattgtttgacagcaggattgtt 10364308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11149267 - 11149364
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
11149267 catcgcagtgattcataactaatttgattcagcaaatcctcggcatcaaagatagcatctttcaagtcatcaagccattgtttgacagcaggattgtt 11149364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 61; E-Value: 9e-27
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 8860933 - 8860845
Alignment:
10 gaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| ||||||||||  |||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||    
8860933 gaatcataactgatttggttgagcaaatcctcagcatcaaagagagcatctttcaagtcatcaagccattgtttgacagcacgattgtt 8860845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 9838517 - 9838431
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||| | |||||||||||| || |||||| |||||||||    
9838517 catcgcagggaatcgtaactgatttcgttgagcaaatcctcagcatcaaagacaacatctttcaagttatcaagccactgtttgaca 9838431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 9849395 - 9849309
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||| | |||||||||||| || |||||| |||||||||    
9849395 catcgcagggaatcgtaactgatttcgttgagcaaatcctcagcatcaaagacaacatctttcaagttatcaagccactgtttgaca 9849309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 10076922 - 10076836
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||||| ||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||| || |||||| ||| |||||    
10076922 catcgcagtgaatcgtaactgatttcgttgagcaagtcctcggcatcaaagacagcatctttcaagttatcaagccactgtctgaca 10076836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 11768890 - 11768793
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    ||||| ||||| || ||||| |||| || ||| || |||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||    
11768890 catcggagggagtcataacttatttgatcgagtaaatcctcagcatcaaagatagcgtctttcaagtcatcaagccattgtttgacagcaagattgtt 11768793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 11160430 - 11160519
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||| ||||||||||||||||| |||||||||||||||||||    
11160430 catcgcagtgattcataactaatttgattcagcaaatcctcggcatcaaagacagcatctttcaagtcatcaagccattgtttgacagca 11160519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 8e-18
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 11131439 - 11131528
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    |||||||| || || ||||| |||| ||| ||||| ||||| |||||||||||||||||||||||||||| || ||||| ||||||||||    
11131439 catcgcagtgactcataactaatttgattcagcaaatcctccgcatcaaagatagcatctttcaagtcatcaacccattttttgacagca 11131528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 31 - 90
Target Start/End: Complemental strand, 10888932 - 10888873
Alignment:
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagca 90  Q
    ||||| ||||| |||||||||| ||||||||||||||||| |||||||||||||||||||    
10888932 agcaaatcctccgcatcaaagacagcatctttcaagtcatcaagccattgtttgacagca 10888873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10517114 - 10517057
Alignment:
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || |||| ||||||||| |||||||||||||||| |||||||||||||||||    
10517114 agcaaatcttcagaatcaaagattgcatctttcaagtcatcaagccattgtttgacag 10517057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10526985 - 10526928
Alignment:
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || ||||||||||| || |||||||||||||||| |||||||||||||||||    
10526985 agcaaatcttcagcatcaaatattgcatctttcaagtcatgaagccattgtttgacag 10526928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 10541600 - 10541543
Alignment:
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || |||||||||||||| |||||||||||||||| ||||||||| |||||||    
10541600 agcaaatcttcagcatcaaagattgcatctttcaagtcatcaagccattgcttgacag 10541543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 31 - 88
Target Start/End: Original strand, 11782422 - 11782479
Alignment:
31 agcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||| || ||||||||||| || |||||||||||||||| |||||||||||||||||    
11782422 agcaaatcttcagcatcaaatattgcatctttcaagtcatcaagccattgtttgacag 11782479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 30 - 88
Target Start/End: Complemental strand, 10500204 - 10500146
Alignment:
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    |||||| || |||||||||||||| |  ||||||||||||| |||||||||||||||||    
10500204 gagcaaatcttcagcatcaaagattgtgtctttcaagtcatcaagccattgtttgacag 10500146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13160636 - 13160546
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13160636 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 13160546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13289321 - 13289231
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13289321 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13289231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13332560 - 13332470
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13332560 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13332470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13170687 - 13170597
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||| ||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13170687 catcggagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 13170597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13343745 - 13343655
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||  ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
13343745 catcgcagggagtcgtagttgatttggttaagcaaatcctcagcatcatagattgcatctttcagctgatccaaccattgtttgacagcag 13343655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 10085735 - 10085678
Alignment:
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||| || ||||||||||||| | |||||||||||| || |||||| |||||||||    
10085735 gagcaaatcttcagcatcaaagaaaacatctttcaagttatcaagccactgtttgaca 10085678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10126572 - 10126511
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||| |||| || ||| ||||||| ||||||||| |||||||||||| |||| ||||||||    
10126572 catcgtagggcattgtagctgatttgattgagcaaatcctcagcatcatagattgcatcttt 10126511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 87
Target Start/End: Complemental strand, 10192655 - 10192598
Alignment:
30 gagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgaca 87  Q
    |||||| || ||||||||||||| | |||||||||||| || |||||| |||||||||    
10192655 gagcaaatcttcagcatcaaagaaaacatctttcaagttatcaagccactgtttgaca 10192598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 10260342 - 10260281
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||| |||| || ||| ||||||| ||||||||| |||||||||||| |||| ||||||||    
10260342 catcgtagggcattgtagctgattttattgagcaaatcctcagcatcatagattgcatcttt 10260281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 10031629 - 10031586
Alignment:
19 ctgatttcattgagcaagtcctcagcatcaaagatagcatcttt 62  Q
    ||||||| ||||||||| |||||||||||| |||| ||||||||    
10031629 ctgatttgattgagcaaatcctcagcatcatagattgcatcttt 10031586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 78; Significance: 7e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 26906553 - 26906456
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| ||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26906553 catcgcagggaatcataactaatttcgttgagcaagtcctcaacatcaaagatagcatctttcaagtcatcaagccattgtttgacagcaggattgtt 26906456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0083 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: scaffold0083
Description:

Target: scaffold0083; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 50218 - 50315
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||||||||||||| |||||||||||  |||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||    
50218 catcgcagggaatcataactgatttcgctgagcaagtcctcagcatcaaagacagcatctttcaagtcatcaagccatagtttgacagcaggattgtt 50315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.000000000000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 11484673 - 11484589
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttga 85  Q
    ||||||| || ||| || ||||||||||| ||||| ||||||||||||||||| |||||||||||   || ||||||||||||||    
11484673 catcgcaaggcatcatagctgatttcattaagcaaatcctcagcatcaaagattgcatctttcaaccgatcaagccattgtttga 11484589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 88
Target Start/End: Original strand, 44958125 - 44958209
Alignment:
4 cgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||||||||| || || ||||  |||||||| ||||| |||||||| || | || ||||||||||| |||||||||||||||||    
44958125 cgcagggaatcatagctaatttggttgagcaaatcctcggcatcaaatattgtatttttcaagtcatcaagccattgtttgacag 44958209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.00000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 98
Target Start/End: Original strand, 31680162 - 31680249
Alignment:
11 aatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcaggattgtt 98  Q
    |||| |||||||| |  |||||||| |||||||||||| | || ||||||||||| |||| ||||||||||||||||| | |||||||    
31680162 aatcataactgatctggttgagcaaatcctcagcatcatatattgcatctttcaactcatcaagccattgtttgacaggaagattgtt 31680249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 35; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 146352 - 146442
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||||||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
146352 catcgcagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 146442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 136301 - 136391
Alignment:
1 catcgcagggaatcgtaactgatttcattgagcaagtcctcagcatcaaagatagcatctttcaagtcattaagccattgtttgacagcag 91  Q
    ||||| ||||| |||||| ||||||  || ||||| |||||||||||| |||| ||||||||||  | ||  | |||||||||||||||||    
136301 catcggagggagtcgtaattgatttggttaagcaaatcctcagcatcatagattgcatctttcagttgatccatccattgtttgacagcag 136391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 46 - 88
Target Start/End: Original strand, 17853378 - 17853420
Alignment:
46 tcaaagatagcatctttcaagtcattaagccattgtttgacag 88  Q
    ||||||||||| |||||||| |||| |||||||||||||||||    
17853378 tcaaagatagcgtctttcaaatcatcaagccattgtttgacag 17853420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC