View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-45 (Length: 113)

Name: NF0440-3-1-Insertion-45
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-45
[»] chr7 (16 HSPs)
chr7 (2-113)||(26297708-26297819)
chr7 (2-113)||(26242660-26242771)
chr7 (2-113)||(26251108-26251219)
chr7 (2-112)||(26191529-26191639)
chr7 (2-112)||(26155467-26155577)
chr7 (2-112)||(26179347-26179457)
chr7 (3-112)||(26302066-26302175)
chr7 (16-112)||(26204158-26204254)
chr7 (16-112)||(26223796-26223892)
chr7 (2-112)||(19103320-19103430)
chr7 (2-112)||(26128831-26128941)
chr7 (3-112)||(26088046-26088155)
chr7 (3-112)||(26111834-26111943)
chr7 (2-112)||(26186506-26186616)
chr7 (16-98)||(26227274-26227356)
chr7 (2-98)||(26207713-26207809)
[»] chr4 (1 HSPs)
chr4 (2-101)||(44903525-44903624)

Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 16)
Name: chr7

Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26297819 - 26297708
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26297819 ccttgttagcccaggctgaaactggtccgacactccatgacttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 26297720  T
102 gttgtatagtga 113  Q
26297719 gttgtatagtga 26297708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26242771 - 26242660
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||  ||| ||||||||||||||||||||||||||||||||    
26242771 ccttgttagcccaggctgaaactggtccgacactccatgatttgattccgattgtagttttactaagattctcataatcactttcaagttcatgaaaact 26242672  T
102 gttgtatagtga 113  Q
26242671 gttgtatagtga 26242660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26251219 - 26251108
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||||||||||||||| ||||||||||||||||||||||  |||||||| |||||| ||||| |||| ||||| |||||| |||||||||||||||||||    
26251219 ccttgttagcccaggcagaaactggtccgacactccatgatttgattccaattgtacttttacaaagcttctcgtaatcattttcaagttcatgaaaact 26251120  T
102 gttgtatagtga 113  Q
26251119 gttgtatagtga 26251108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26191639 - 26191529
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||| |||||||| |||||||||||||| |||||||| |  ||||| ||  ||||||| ||| ||||||||||||| |||||||| ||||||||||||||    
26191639 cctttttagcccaagctgaaactggtcctacactccaagatttgatcccccttgtagtattacaaagtttctcatattcactttctagttcatgaaaact 26191540  T
102 gttgtatagtg 112  Q
26191539 attgtatagtg 26191529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26155577 - 26155467
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| |  ||||| || || ||||| |||  |||||| |||||||||||||| ||||||||||||||    
26155577 ccttgttagcccatgatgaaactggtcctacactccaagttttgatccccatggtagtgttactaagtttttcataatcactttccagttcatgaaaact 26155478  T
102 gttgtatagtg 112  Q
26155477 attgtatagtg 26155467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26179457 - 26179347
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||| ||| |||||||||||||| |||||||| |  ||||| || |||||||| |||   | ||| |||||||||||||||||||||||||||||    
26179457 ccttgttagtccaagctgaaactggtcctacactccaagttttgatccccattgtagtgttacttaatttttcataatcactttcaagttcatgaaaact 26179358  T
102 gttgtatagtg 112  Q
26179357 attgtatagtg 26179347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26302175 - 26302066
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    ||||||||||||  | ||||||||||| ||| |||| |  |||||||| ||||| |||| |  ||||||| ||||||||||||||||||||||||||||     
26302175 cttgttagcccaaacagaaactggtcctacattccaagatttgattcccattgttgtttgactaagtttcacataatcactttcaagttcatgaaaacta 26302076  T
103 ttgtatagtg 112  Q
26302075 ttgtatagtg 26302066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 26204254 - 26204158
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactgttgtatagtg 112  Q
    |||||||| ||||| | |||||| |  ||||| || ||||||||||||  ||||||||||||||||||||| |||||||||||||| ||||||||||    
26204254 gctgaaaccggtcctatactccaagatttgatccctattgtagttttaccaagtttctcataatcactttctagttcatgaaaactattgtatagtg 26204158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 26223892 - 26223796
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactgttgtatagtg 112  Q
    |||||||| ||||| | |||||| |  ||||| || ||||||||||||  ||||||||||||||||||||| |||||||||||||| ||||||||||    
26223892 gctgaaaccggtcctatactccaagatttgatccctattgtagttttaccaagtttctcataatcactttctagttcatgaaaactattgtatagtg 26223796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 2 - 112
Target Start/End: Original strand, 19103320 - 19103430
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||  |||||||||||||| |||| ||| |  ||||| || | |||||| |||  ||||||  ||||||||||||| ||||||||||||||    
19103320 ccttgttagccctagctgaaactggtcctacacaccaagatttgatccccaatgtagtcttaccaagttttacataatcactttccagttcatgaaaact 19103419  T
102 gttgtatagtg 112  Q
19103420 attgtatagtg 19103430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26128941 - 26128831
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| |  ||||| || |  ||||| ||| |||  || |||||||||||||| ||||||||||||||    
26128941 ccttgttagcccatgatgaaactggtcctacactccaagatttgatccccaaggtagtgttacaaatgttttcataatcactttccagttcatgaaaact 26128842  T
102 gttgtatagtg 112  Q
     ||| ||||||    
26128841 attgcatagtg 26128831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26088155 - 26088046
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    |||||| | ||| ||||||||||| || |||||||| |  ||||| || ||||||||  |   |||||| |||||||||||||| ||||||||||||||     
26088155 cttgttggtccaagctgaaactggccctacactccaagatttgatccccattgtagtgcttccaagtttttcataatcactttccagttcatgaaaacta 26088056  T
103 ttgtatagtg 112  Q
26088055 ttgtatagtg 26088046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26111943 - 26111834
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    |||||| | ||| ||||||||||| || |||||||| |  ||||| || ||||||||  |   |||||| |||||||||||||| ||||||||||||||     
26111943 cttgttggtccaagctgaaactggccctacactccaagatttgatccccattgtagtgcttccaagtttttcataatcactttccagttcatgaaaacta 26111844  T
103 ttgtatagtg 112  Q
26111843 ttgtatagtg 26111834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26186616 - 26186506
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||| | | |||||||||||| ||||||||||  ||||| || |   |||| |||  |||||| | ||||||||| || ||||||||||||||    
26186616 ccttgttagccaatgatgaaactggtcctacactccatgatttgatccccaagatagtgttactaagttttttataatcactctccagttcatgaaaact 26186517  T
102 gttgtatagtg 112  Q
26186516 attgtatagtg 26186506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 26227356 - 26227274
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaa 98  Q
    |||||||||||||| ||||||||||  ||||| || |||||  | ||  |||| ||||||||||||| ||||||||| |||||    
26227356 gctgaaactggtcctacactccatgctttgatccccattgtgctcttgtaaagattctcataatcaccttcaagttcgtgaaa 26227274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 26207809 - 26207713
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaa 98  Q
    |||| ||| |||| |||||||||||||| || |||||||  ||||| || |||||  | ||  |||| ||||||||||||| ||||||||| |||||    
26207809 cctttttaacccatgctgaaactggtcctacgctccatgctttgatccccattgtgctcttgtaaagattctcataatcaccttcaagttcgtgaaa 26207713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 1e-23; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 2 - 101
Target Start/End: Complemental strand, 44903624 - 44903525
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| | ||| || || ||||||||||||  || |||||||||||||||||||||||||||||||||    
44903624 ccttgttagcccaagttgaaactggtcctacactccaagacttaatccccattgtagttttactaactttctcataatcactttcaagttcatgaaaact 44903525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 93639 times since January 2019
Visitors: 2365