View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-45 (Length: 113)

Name: NF0440-3-1-Insertion-45
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-45
NF0440-3-1-Insertion-45
[»] chr7 (16 HSPs)
chr7 (2-113)||(26297708-26297819)
chr7 (2-113)||(26242660-26242771)
chr7 (2-113)||(26251108-26251219)
chr7 (2-112)||(26191529-26191639)
chr7 (2-112)||(26155467-26155577)
chr7 (2-112)||(26179347-26179457)
chr7 (3-112)||(26302066-26302175)
chr7 (16-112)||(26204158-26204254)
chr7 (16-112)||(26223796-26223892)
chr7 (2-112)||(19103320-19103430)
chr7 (2-112)||(26128831-26128941)
chr7 (3-112)||(26088046-26088155)
chr7 (3-112)||(26111834-26111943)
chr7 (2-112)||(26186506-26186616)
chr7 (16-98)||(26227274-26227356)
chr7 (2-98)||(26207713-26207809)
[»] chr4 (1 HSPs)
chr4 (2-101)||(44903525-44903624)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 16)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26297819 - 26297708
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26297819 ccttgttagcccaggctgaaactggtccgacactccatgacttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 26297720  T
102 gttgtatagtga 113  Q
    ||||||||||||    
26297719 gttgtatagtga 26297708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26242771 - 26242660
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||  ||| ||||||||||||||||||||||||||||||||    
26242771 ccttgttagcccaggctgaaactggtccgacactccatgatttgattccgattgtagttttactaagattctcataatcactttcaagttcatgaaaact 26242672  T
102 gttgtatagtga 113  Q
    ||||||||||||    
26242671 gttgtatagtga 26242660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 26251219 - 26251108
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||||||||||||||| ||||||||||||||||||||||  |||||||| |||||| ||||| |||| ||||| |||||| |||||||||||||||||||    
26251219 ccttgttagcccaggcagaaactggtccgacactccatgatttgattccaattgtacttttacaaagcttctcgtaatcattttcaagttcatgaaaact 26251120  T
102 gttgtatagtga 113  Q
    ||||||||||||    
26251119 gttgtatagtga 26251108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26191639 - 26191529
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    |||| |||||||| |||||||||||||| |||||||| |  ||||| ||  ||||||| ||| ||||||||||||| |||||||| ||||||||||||||    
26191639 cctttttagcccaagctgaaactggtcctacactccaagatttgatcccccttgtagtattacaaagtttctcatattcactttctagttcatgaaaact 26191540  T
102 gttgtatagtg 112  Q
     ||||||||||    
26191539 attgtatagtg 26191529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26155577 - 26155467
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| |  ||||| || || ||||| |||  |||||| |||||||||||||| ||||||||||||||    
26155577 ccttgttagcccatgatgaaactggtcctacactccaagttttgatccccatggtagtgttactaagtttttcataatcactttccagttcatgaaaact 26155478  T
102 gttgtatagtg 112  Q
     ||||||||||    
26155477 attgtatagtg 26155467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26179457 - 26179347
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||| ||| |||||||||||||| |||||||| |  ||||| || |||||||| |||   | ||| |||||||||||||||||||||||||||||    
26179457 ccttgttagtccaagctgaaactggtcctacactccaagttttgatccccattgtagtgttacttaatttttcataatcactttcaagttcatgaaaact 26179358  T
102 gttgtatagtg 112  Q
     ||||||||||    
26179357 attgtatagtg 26179347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26302175 - 26302066
Alignment:
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    ||||||||||||  | ||||||||||| ||| |||| |  |||||||| ||||| |||| |  ||||||| ||||||||||||||||||||||||||||     
26302175 cttgttagcccaaacagaaactggtcctacattccaagatttgattcccattgttgtttgactaagtttcacataatcactttcaagttcatgaaaacta 26302076  T
103 ttgtatagtg 112  Q
    ||||||||||    
26302075 ttgtatagtg 26302066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 26204254 - 26204158
Alignment:
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactgttgtatagtg 112  Q
    |||||||| ||||| | |||||| |  ||||| || ||||||||||||  ||||||||||||||||||||| |||||||||||||| ||||||||||    
26204254 gctgaaaccggtcctatactccaagatttgatccctattgtagttttaccaagtttctcataatcactttctagttcatgaaaactattgtatagtg 26204158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 26223892 - 26223796
Alignment:
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactgttgtatagtg 112  Q
    |||||||| ||||| | |||||| |  ||||| || ||||||||||||  ||||||||||||||||||||| |||||||||||||| ||||||||||    
26223892 gctgaaaccggtcctatactccaagatttgatccctattgtagttttaccaagtttctcataatcactttctagttcatgaaaactattgtatagtg 26223796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 2 - 112
Target Start/End: Original strand, 19103320 - 19103430
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||  |||||||||||||| |||| ||| |  ||||| || | |||||| |||  ||||||  ||||||||||||| ||||||||||||||    
19103320 ccttgttagccctagctgaaactggtcctacacaccaagatttgatccccaatgtagtcttaccaagttttacataatcactttccagttcatgaaaact 19103419  T
102 gttgtatagtg 112  Q
     ||||||||||    
19103420 attgtatagtg 19103430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26128941 - 26128831
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| |  ||||| || |  ||||| ||| |||  || |||||||||||||| ||||||||||||||    
26128941 ccttgttagcccatgatgaaactggtcctacactccaagatttgatccccaaggtagtgttacaaatgttttcataatcactttccagttcatgaaaact 26128842  T
102 gttgtatagtg 112  Q
     ||| ||||||    
26128841 attgcatagtg 26128831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26088155 - 26088046
Alignment:
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    |||||| | ||| ||||||||||| || |||||||| |  ||||| || ||||||||  |   |||||| |||||||||||||| ||||||||||||||     
26088155 cttgttggtccaagctgaaactggccctacactccaagatttgatccccattgtagtgcttccaagtttttcataatcactttccagttcatgaaaacta 26088056  T
103 ttgtatagtg 112  Q
    ||||||||||    
26088055 ttgtatagtg 26088046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 3 - 112
Target Start/End: Complemental strand, 26111943 - 26111834
Alignment:
3 cttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaactg 102  Q
    |||||| | ||| ||||||||||| || |||||||| |  ||||| || ||||||||  |   |||||| |||||||||||||| ||||||||||||||     
26111943 cttgttggtccaagctgaaactggccctacactccaagatttgatccccattgtagtgcttccaagtttttcataatcactttccagttcatgaaaacta 26111844  T
103 ttgtatagtg 112  Q
    ||||||||||    
26111843 ttgtatagtg 26111834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 26186616 - 26186506
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||| | | |||||||||||| ||||||||||  ||||| || |   |||| |||  |||||| | ||||||||| || ||||||||||||||    
26186616 ccttgttagccaatgatgaaactggtcctacactccatgatttgatccccaagatagtgttactaagttttttataatcactctccagttcatgaaaact 26186517  T
102 gttgtatagtg 112  Q
     ||||||||||    
26186516 attgtatagtg 26186506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 26227356 - 26227274
Alignment:
16 gctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaa 98  Q
    |||||||||||||| ||||||||||  ||||| || |||||  | ||  |||| ||||||||||||| ||||||||| |||||    
26227356 gctgaaactggtcctacactccatgctttgatccccattgtgctcttgtaaagattctcataatcaccttcaagttcgtgaaa 26227274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 26207809 - 26207713
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaa 98  Q
    |||| ||| |||| |||||||||||||| || |||||||  ||||| || |||||  | ||  |||| ||||||||||||| ||||||||| |||||    
26207809 cctttttaacccatgctgaaactggtcctacgctccatgctttgatccccattgtgctcttgtaaagattctcataatcaccttcaagttcgtgaaa 26207713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 1e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 2 - 101
Target Start/End: Complemental strand, 44903624 - 44903525
Alignment:
2 ccttgttagcccaggctgaaactggtccgacactccatggcttgattccgattgtagttttaaaaagtttctcataatcactttcaagttcatgaaaact 101  Q
    ||||||||||||| | |||||||||||| |||||||| | ||| || || ||||||||||||  || |||||||||||||||||||||||||||||||||    
44903624 ccttgttagcccaagttgaaactggtcctacactccaagacttaatccccattgtagttttactaactttctcataatcactttcaagttcatgaaaact 44903525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC