View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-46 (Length: 69)

Name: NF0440-3-1-Insertion-46
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-46
NF0440-3-1-Insertion-46
[»] chr2 (1 HSPs)
chr2 (3-65)||(3383870-3383932)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 3383932 - 3383870
Alignment:
3 gtggaagttggttttaggatggtgtgggttgtagagtcggtaatagtgaaagtatttcatttt 65  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
3383932 gtggaagttggttttaggatggtgtgggttgtagagtcggtaatggtgaaagtatttcctttt 3383870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105331 times since January 2019
Visitors: 2324