View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-47 (Length: 92)

Name: NF0440-3-1-Insertion-47
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-47
[»] chr1 (1 HSPs)
chr1 (2-92)||(9951325-9951415)

Alignment Details
Target: chr1 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 9951325 - 9951415
2 cagaatgctctgttttgaaattatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacatgaatgaag 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
9951325 cagaatgctctgttttgaaattatactagtgaaattgttttgtacaaaatttaatcattaaccccgtcacttttatgttacaagaatgaag 9951415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC