View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-49 (Length: 60)

Name: NF0440-3-1-Insertion-49
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-49
NF0440-3-1-Insertion-49
[»] chr8 (2 HSPs)
chr8 (2-60)||(44729087-44729145)
chr8 (1-36)||(12729398-12729433)
[»] chr4 (1 HSPs)
chr4 (2-60)||(24391843-24391903)
[»] chr3 (1 HSPs)
chr3 (2-60)||(40574362-40574422)


Alignment Details
Target: chr8 (Bit Score: 51; Significance: 5e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 44729087 - 44729145
Alignment:
2 attctttcatttccctagtgcacgagagaaattgataactacattctgtaaactatcat 60  Q
    ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||    
44729087 attctttcatttccctagtgcacgagagagattgacaactacattctgtaaactatcat 44729145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 12729398 - 12729433
Alignment:
1 aattctttcatttccctagtgcacgagagaaattga 36  Q
    ||||||||| |||| |||||||||||||||||||||    
12729398 aattctttcttttctctagtgcacgagagaaattga 12729433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 24391843 - 24391903
Alignment:
2 attctttcatttccctagtgcacgagagaaattg--ataactacattctgtaaactatcat 60  Q
    |||||||| |||| |||||||| |||||||||||  ||||||  |||||||||||||||||    
24391843 attctttcttttctctagtgcatgagagaaattgacataactttattctgtaaactatcat 24391903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 60
Target Start/End: Complemental strand, 40574422 - 40574362
Alignment:
2 attctttcatttccctagtgcacgagagaaattg--ataactacattctgtaaactatcat 60  Q
    |||||||| |||| ||||||||||||||||||||  | ||||  |||||||||||||||||    
40574422 attctttcttttctctagtgcacgagagaaattgacagaactttattctgtaaactatcat 40574362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC