View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-5 (Length: 225)

Name: NF0440-3-1-Insertion-5
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-5
[»] chr2 (1 HSPs)
chr2 (10-225)||(5173468-5173684)

Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 5173684 - 5173468
10 acaattgaagttcaaaaggttcgtcatccaaa-tttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataacccggaat 108  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5173684 acaattgaagttcaaaaggttcgtcatccaaaatttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataacccggaat 5173585  T
109 ttgcaaacatggtagcacaagcaactgataatggaatccgtagccgaaagaaatcatcaagaggtcaccacaggtttgtaggagttcgtcaaaggccgtc 208  Q
5173584 ttgcaaacatggtagcacaagcaactgataatggaatccgtagccgaaagaaatcatcaagaggtcaccacaggtttgtaggagttcgtcaaaggccgtc 5173485  T
209 cggaagatgggtagcag 225  Q
5173484 cggaagatgggtagcag 5173468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98503 times since January 2019
Visitors: 2275