View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-5 (Length: 225)

Name: NF0440-3-1-Insertion-5
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440-3-1-Insertion-5
NF0440-3-1-Insertion-5
[»] chr2 (1 HSPs)
chr2 (10-225)||(5173468-5173684)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 225
Target Start/End: Complemental strand, 5173684 - 5173468
Alignment:
10 acaattgaagttcaaaaggttcgtcatccaaa-tttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataacccggaat 108  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5173684 acaattgaagttcaaaaggttcgtcatccaaaatttagtgacacaattgagacatcaaatctatttttatcattagaaatctaactcaataacccggaat 5173585  T
109 ttgcaaacatggtagcacaagcaactgataatggaatccgtagccgaaagaaatcatcaagaggtcaccacaggtttgtaggagttcgtcaaaggccgtc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5173584 ttgcaaacatggtagcacaagcaactgataatggaatccgtagccgaaagaaatcatcaagaggtcaccacaggtttgtaggagttcgtcaaaggccgtc 5173485  T
209 cggaagatgggtagcag 225  Q
    |||||||||||||||||    
5173484 cggaagatgggtagcag 5173468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC