View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440-3-1-Insertion-8 (Length: 85)

Name: NF0440-3-1-Insertion-8
Description: 454-NF0440-3-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0440-3-1-Insertion-8
[»] chr4 (2 HSPs)
chr4 (7-85)||(21146915-21146994)
chr4 (40-85)||(21126821-21126866)

Alignment Details
Target: chr4 (Bit Score: 60; Significance: 3e-26; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-26
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 21146994 - 21146915
7 attgacaga-aaattaaatccttgtcctattcaagttcccttgcatccagtttgccaacatctgaagtgcaacttttggt 85  Q
    ||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||    
21146994 attgacagataaattaaatacttgtcctattcaagttcccatgcatccagtttgccaacatctgaagtgcagcttttggt 21146915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 21126866 - 21126821
40 gttcccttgcatccagtttgccaacatctgaagtgcaacttttggt 85  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||    
21126866 gttcccatgcatccagtttgccaacatctgaagtgcagcttttggt 21126821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC